Pac Cranberri

8/13/2019 Pac Cranberri

1/13

This article was downloaded by: [202.67.42.25]On: 03 December 2013, At: 16:59Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House37-41 Mortimer Street, London W1T 3JH, UK

Biofouling: The Journal of Bioadhesion and Biofilm

Research

Publication details, including instructions for authors and subscription information:http://www.tandfonline.com/loi/gbif20

The specific degree-of-polymerization of A-type

proanthocyanidin oligomers impacts Streptococcus

mutans glucan-mediated adhesion and transcriptome

responses within biofilmsGuoping Feng

a, Marlise I. Klein

a, Stacy Gregoire

a, Ajay P. Singh

b, Nicholi Vorsa

bc&

Hyun Kooad

aCenter for Oral Biology, University of Rochester Medical Center , Rochester , NY , USA

b

Department of Plant Biology and Plant Pathology , Rutgers University , New Brunswick ,NJ , USAcPhilip E. Marucci Center for Blueberry and Cranberry Research and Extension, Rutgers

University , Chatsworth , NJ , USAdDepartment of Microbiology and Immunology , University of Rochester Medical Center ,

Rochester , NY , USA

Published online: 22 May 2013.

To cite this article:Guoping Feng , Marlise I. Klein , Stacy Gregoire , Ajay P. Singh , Nicholi Vorsa & Hyun Koo (2013) Thespecific degree-of-polymerization of A-type proanthocyanidin oligomers impacts Streptococcus mutans glucan-mediated

adhesion and transcriptome responses within biofilms, Biofouling: The Journal of Bioadhesion and Biofilm Research, 29:6,

629-640, DOI: 10.1080/08927014.2013.794456

To link to this article: http://dx.doi.org/10.1080/08927014.2013.794456

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the Content) containedin the publications on our platform. However, Taylor & Francis, our agents, and our licensors make norepresentations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of tContent. Any opinions and views expressed in this publication are the opinions and views of the authors, andare not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon a

should be independently verified with primary sources of information. Taylor and Francis shall not be liable forany losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoeveor howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use ofthe Content.

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in anyform to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions
http://www.tandfonline.com/page/terms-and-conditionshttp://www.tandfonline.com/page/terms-and-conditionshttp://dx.doi.org/10.1080/08927014.2013.794456http://www.tandfonline.com/action/showCitFormats?doi=10.1080/08927014.2013.794456http://www.tandfonline.com/loi/gbif20


2/13

The specic degree-of-polymerization of A-type proanthocyanidin oligomers impacts

Streptococcus mutans glucan-mediated adhesion and transcriptome responses within bio

lmsGuoping Fenga, Marlise I. Kleina, Stacy Gregoirea, Ajay P. Singhb, Nicholi Vorsab,c and Hyun Kooa,d*

aCenter for Oral Biology, University of Rochester Medical Center, Rochester, NY, USA; bDepartment of Plant Biology and PlantPathology, Rutgers University, New Brunswick, NJ, USA; cPhilip E. Marucci Center for Blueberry and Cranberry Research andExtension, Rutgers University, Chatsworth, NJ, USA;

dDepartment of Microbiology and Immunology, University of Rochester Medical

Center, Rochester, NY, USA

(Received 15 January 2013;nal version received 28 March 2013)

Cranberry A-type proanthocyanidins (PACs) have been recognized for their inhibitory activity against bacterial adhesionand biolm-derived infections. However, the precise identication of the specic classes of degree-of-polymerization(DP) conferring PACs bioactivity remains a major challenge owing to the complex chemistry of these avonoids. In thisstudy, chemically characterized cranberries were used in a multistep separation and structure-determination technique toisolate A-type PAC oligomers of dened DP. The inuences of PACs on the 3D architecture of biolms and

Streptococcus mutans-transcriptome responses within biolms were investigated. Treatment regimens that simulatedtopical exposures experienced clinically (twice-daily, 60 s each) were used over a saliva-coated hydroxyapatite biolmmodel. Biolm accumulation was impaired, while specic genes involved in the adhesion of bacteria, acid stress toler-ance, and glycolysis were affected by the topical treatments (vs the vehicle-control). Genes (rmpC, mepA, sdcBB, andgbpC) associated with sucrose-dependent binding of bacteria were repressed by PACs. PACs of DP 4 and particularlyDP 8 to 13 were the most effective in disrupting bacterial adhesion to glucan-coated apatitic surface (>85% inhibition vsvehicle control), and gene expression (eg rmpC). This study identied putative molecular targets of A-type cranberryPACs in S. mutans while demonstrating that PAC oligomers with a specic DP may be effective in disrupting theassembly of cariogenic biolms.

Keywords:Streptococcus mutans; biolm; cranberry; proanthocyanidin; adhesion

Introduction

Biolms are highly organized and structured microbial

communities enmeshed in an extracellular matrixcomprised mainly of polysaccharides and proteins

(Flemming & Wingender 2010). Biolms are the prevail-

ing microbial lifestyle in natural niches, causing many

diseases in humans including those occurring in the

mouth, such as dental caries (OToole et al. 2000;

Hall-Stoodley et al. 2004). Dental caries is one of the

most prevalent and costly biolm-dependent oral

diseases worldwide (Marsh 2003).

In the mouth, the assembly of cariogenic biolms is a

prime example of the consequences arising from interac-

tions between bacteria (and their products) and dietary

sugars on pellicle-coated tooth surfaces. Within the

complex oral microbiome, Streptococcus mutans (one of

the main species responsible for dental caries) is not

always the most abundant organism. However, it can rap-

idly orchestrate the formation of cariogenic biolms when

sucrose becomes available (Paes Leme et al. 2006; Klein

et al. 2012). S. mutans-derived glucosyltransferases (Gtfs)

are present in the tooth pellicle and on microbial surfaces,

producing exopolysaccharides (EPS) in situ (Schilling &

Bowen 1992; Vacca-Smith & Bowen 1998; Gregoire et al.2011). The EPS formed on surfaces provides binding sites

for bacteria (particularly for S. mutans) promoting local

accumulation of microbes while forming a diffusion-limit-

ing polymeric matrix that protects embedded bacteria

(Stewart & Franklin 2008; Xiao et al. 2012).

In parallel, sucrose (and other sugars) is also

fermented by S. mutans and other acidogenic bacteria

within the EPS-rich matrix, creating acidic microenviron-

ments across the biolm and at the attachment surface

(Xiao et al. 2012). The low pH environment facilitates

EPS production while acid-tolerant and acidogenic ora

prosper within biolms, ensuring continued accumulation

of EPS and acids that promote biolm accretion andlocalized dissolution of the adjacent tooth enamel (Paes

Leme et al. 2006). Once the biolm is established, the

resident bacteria become recalcitrant to antimicrobial

therapies, making them difcult to remove while

facilitating their virulence expression (Lewis 2001).

*Corresponding author. Email: [email protected]

Present address: Department of Food Science, Cornell University, Ithaca, NY 14853, USA.

Biofouling, 2013

Vol. 29, No. 6, 629640, http://dx.doi.org/10.1080/08927014.2013.794456

2013 Taylor & Francis


3/13

Therefore, interventions that target EPS-mediated

bacterial binding and biolm assembly could disrupt the

pathogenesis of dental caries in a highly precise manner.

Cranberries are widely cultivated and consumed, par-

ticularly in the USA. Cranberry fruit is a rich source of

various classes of avonoids including avonols, antho-

cyanins, and proanthocyanidins (PACs; polymeric

avan-3-ols), and offers signicant therapeutic potential (Cote

et al. 2010). Cranberry juice and aqueous extracts have

been recognized for their anti-adhesion and anti-biolm

activity against several bacterial pathogens including the

uropathogenic Escherichia coli and Helicobacter pylori

(Howell et al. 1998; Burger et al. 2000; Liu et al. 2006;

Koo, Duarte, et al. 2010). The extracts also affected the

swarming activity of Pseudomonas aeruginosa (OMay

& Tufenkji 2011). PACs appear to be the main bioactive

avonoid. PACs in cranberry are predominantly found in

oligomeric forms (up to 13 monomeric units) with at

least one A-type double interavan linkage [epicatechin-

(4 8, 2O 7)-epicatechin] (Foo et al. 2000a).This double linkage affords conformational rigidity to

PACs and appears to play a role in their anti-adhesion

bioactivity (Foo et al. 2000b; Howell et al. 2005). A-type

PACs are found in high concentrations uniquely in cran-

berries. A-type PACs appear to be more bioactive than

B-type PACs, which lack the second interavan linkage,

and which are found in other tannin-rich foods (Yanagida

et al. 2000; Foo et al. 2000b; Howell et al. 2005;

Gregoire et al. 2007).

Previous studies have shown that PACs-containing

extract is highly effective in inhibiting the synthesis of

EPS by surface-adsorbed Gtfs, and impairing the accumu-

lation of biolms ofS. mutans on apatitic surfaces (Duarteet al. 2006). Recently, it was reported that topical applica-

tion of an extract containing cranberry PACs reduced the

incidence of dental caries in vivo (Koo, Duarte, et al.

2010). Interestingly, the PACs neither affected bacterial

growth in vitro nor the number of viable populations

in vivo (Duarte et al. 2006; Koo, Duarte, et al. 2010).

Although previous studies have shown the anti-adhesion/

anti-biolm properties of cranberry extracts, the identity of

the bioactive PACs and their molecular targets against S.

mutansremain to be elucidated. The isolation of individual

PAC oligomers from cranberries is challenging due to their

complex chemistry and multiple degrees-of-polymeriza-

tion (DP) with similar mass to charge ratios. Yet, it is a

critical step for further elucidation of the mechanisms of

action and standardization/characterization of this natural

product, both of which are key factors for the successful

development of useful therapies to treat human diseases

(Schmidt et al. 2007).

In this study, a chemically characterized cranberry cul-

tivar which is propagated clonally and consists of a single

genotype was used. A step-wise chromatographic isola-

tion method yielded a highly reproducible PACs-enriched

fraction and individual PACs. It was found that cranberry

PACs modulate the expression of several virulence factors

associated with sucrose-dependent adhesion. The bioac-

tivity of individual PACs on the S. mutans transcriptome

and bacterial adhesion varied depending on their DP. The

data provide insights into the potential therapeutic targets

and the identity of cranberry PACs with high potency,which could be used to design new therapies to be evalu-

ated in vivo.

Materials and methods

Cranberry source and extraction procedures

The fruit source for the PAC oligomers was from the

cranberry cultivar Stevens, which was grown and

harvested from the variety trial at the PE Marucci Center,

Rutgers University, Chatsworth, NJ. Stevens is well-

dened genetically (Fajardo et al. 2012), and is a widely

grown commercial cranberry cultivar with a high avo-

noid content (Vvedenskaya & Vorsa 2004). Cranberrieswere grown under standard (and monitored) nutritional

and cultivation conditions. Plants of the cultivar

Stevens in eld plots were ngerprinted using DNA

SCAR proling to conrm the genotype and to verify

that there was no contamination by genetic off-types

(Polashock & Vorsa 2002).

Isolation and purication of cranberry A-type PACs

oligomers

Fruit was harvested early in the season, prior to fruit

anthocyanin synthesis, and used for the isolation A-type

PACs. The cranberry PACs-containing fraction was

obtained as described previously (Koo, Duarte, et al.2010). The puried fraction contained oligomers (210),

and polymers 11, 12, and 13, and was devoid of any

otheravonoid contaminants (eg avonols and anthocya-

nins). Individual PACs were further isolated and puried

using a method published previously based on HPLC

and diol gravity column chromatography (Singh et al.

2009). The purity of all isolated PAC DP classes was

>95% (w/w) as determined using liquid chromatography-

mass spectrometry (LC-MS-MS) and matrix-assisted

laser desorption/ionization time-of-ight mass spectrome-

try (MALDI-TOF-MS). The treatment concentrations

used for the microarray analysis were 1.5 mg ml1 of the

puried PAC only-fraction, which was selected based on

a previous study (Koo, Duarte, et al. 2010). For compar-

ing the bioactivity of the various PAC molecules of dif-

ferent DP, the treatment concentration was 100M for

DP 2, DP 3, DP 4, DP 56 (combined 1:1 equimolar),

DP 89 (combined 1:1), DP 1011 (combined 1:1), and

DP 1213 (combined 1:1), which was the approximate

amount present in the PAC extract. All compounds were

dissolved in 15% ethanol in 2.5 mM potassium phos-

phate buffer, which was also used as a vehicle control;

630 G. Fenget al.


4/13

treatments with 15% ethanol did not affect the viability

of cells of S. mutans in a biolm when compared to

untreated controls. The pH of the treatment solutions

was maintained at 6.5 0.2. Based on stability studies

(data not shown) the isolated PACs were found to be

stable at pH 6.5, with enhanced solubility.

Preparation and treatment of the biolm

Biolms of S. mutans were formed on saliva coated

hydroxyapatite (sHA) surfaces (12.7 mm in diameter,

1 mm in thickness, Clarkson Chromatography Products

Inc., South Williamsport, PA) as detailed elsewhere

(Koo, Xiao, et al. 2010). S. mutans UA159 (ATCC

700610), a cariogenic oral pathogen whose genome has

been sequenced (Ajdic et al. 2002) was used in this

study. The biolms were grown in ultra-ltered

(10 kDaMW cut-off membrane; Prep/Scale, Millipore,

MA) buffered tryptone-yeast extract broth (UFTYE;

2.5% tryptone and 1.5% yeast extract with the addition

of 4.35 g l1

of potassium phosphate and 1 g l1

ofMgSO47H2O, pH 7.0) with 1% sucrose at 37C and

5% CO2. Briey,S. mutans in exponential growth phase

was inoculated into 2.8 ml of UFTYE + 1% sucrose

containing sHA discs placed vertically in a custom-made

holder. Biolms were allowed to form on sHA discs

without interruption for the rst 20 h. Subsequently, the

biolms were treated twice with each of the test agents

or vehicle control, at 10 am (22 h-old) and 4 pm (28 h-

old), with an additional treatment the following morning

(10 am; 46h-old). The biolms were exposed to the

treatments for 60 s, dip-washed in sterile saline solution

(0.89% w/v NaCl) to remove excess agents, and then

transferred to fresh culture medium (Koo, Duarte, et al.2010). The biolm was analyzed after 44 h using confo-

cal microscopy (Olympus FV 1000, Olympus, Tokyo,

Japan) to examine the effects on the overall 3D architec-

ture after receiving the initial topical treatments. The

gene expression prole was determined 4 h after the last

topical treatment at 46 h (Figure 1), to evaluate the

impact of PACs on S. mutans within the accumulated

biolms post-treatment. The time-points represent the

most active period of the biolm development process in

this model, and were selected based on recent studies on

the dynamics of the S. mutans transcriptome during bio-

lm development and in response to topically applied

agents (Klein et al. 2010; Falsetta et al. 2012).

Confocal laser scanning microscopy of biolms

The overall effect of topical applications of the PACs

fraction on the 3D architecture, and the amount of EPS

and bacteria biomass within intact biolms was assessed

using confocal uorescence imaging (Xiao et al. 2012).

EPS was labeled via incorporation of the Alexa Fluor

647 dextran conjugate (MW 10 kDa; absorbance/uores-

cence emission maxima of 647/668nm), while cells of

S. mutans were stained with SYTO 9 (485/498 nm)

(Molecular Probes Inc., Eugene, OR) as detailed else-

where (Xiao et al. 2012). Imaging was performed using

an Olympus FV 1000 two-photon laser scanning micro-scope (Olympus, Tokyo, Japan) equipped with a 10

(0.45 numerical aperture) water immersion objective

lens. Each biolm was scanned at 5, randomly selected,

positions on the microscope stage and the confocal

image series were generated by optical sectioning at each

of these positions. Three independent experiments were

conducted. The step size of z-series scanning was 2 m.

The confocal images were analyzed using software for

simultaneous visualization and quantication of EPS and

bacterial cells within intact biolms (Koo, Xiao, et al.

2010; Xiao et al. 2012). Amira 5.4.1 software (Visage

Imaging, San Diego, CA) was used to create 3D render-

ings of each structural component (EPS and bacteria) tovisualize the architecture of the biolm. COMSTAT was

used to calculate the biomass and average thickness of

the treated biolms (Heydorn et al. 2000).

Isolation and purication of RNA from the biolm

RNA was extracted and puried using standard protocols

optimized for biolms (Cury & Koo 2007). The RNA

Figure 1. The experimental design for the treatment and analysis of biolms ofS. mutans.

Biofouling 631


5/13

integrity numbers of puried samples used for microarray

and RT-qPCR were P9 as determined by microcapillary

electrophoresis and Agilent 2100 Bioanalyzer (Agilent

Technologies, Santa Clara, CA) (Schroeder et al. 2006).

Puried RNA samples were stored in RNase-free water at

80 C. The RNA used as a normalization reference for

microarray analysis was isolated from planktonicS. mutans UA159 with the same method.

Microarray experiments: cDNA synthesis, labeling, and

microarray hybridization

Whole genomic proling was conducted using S. mutans

UA159 microarrays (version 3) provided by the J. Craig

Venter Institute (JCVI). Details about the arrays are

available at http://pfgrc.jcvi.org/index.php/microarray/array_

description/Streptococcus_mutans/version3.html . The exper-

imental RNAs from biolms and the reference RNA were

used to generate cDNA according to the protocol provided

by JCVI athttp://pfgrc.jcvi.org/index.php/microarray/pro-

tocols.html. Puried experimental cDNAs were coupledwith indocarbocyanine (Cy3)-dUTP, while reference

cDNA was coupled with indodicarbocyanine (Cy5)-dUTP

(Amersham, GE Healthcare, Little Chalfont, UK). Hybrid-

izations were carried out at 42 C for 17 h with a Maui

hybridization system (Biomicro Systems, Salt Lake City,

UT). The slides were then washed according to JCVI

protocols and scanned using a GenePix 4000B scanner

(Molecular Devices, Sunnyvale, CA) at 532 nm (Cy3

channel) and 635 nm (Cy5 channel).

Microarray data analysis

After the slides were scanned, single-channel images

were loaded into JCVI Spotnder software (http://www.tm4.org/spotnder.html) and overlaid. A spot grid was

created according to JCVI specications and then manu-

ally adjusted to t all spots within the grid. The intensity

values of each spot were measured and saved into .mev

les. Data were normalized using LOWESS and standard

deviation regularization with default settings, followed by

in-slide replicate analysis using the JCVI microarray data

analysis software MIDAS (http://www.tm4.org/midas.

html). Spots that were agged as having either low inten-

sity values or low signal saturation were discarded auto-

matically. The statistical analysis was carried out using

BRB-ArrayTools (version 3.8.1; http://linus.nci.nih.gov/

BRB-ArrayTools.html) with a cutoffp value of 0.001 for

class prediction and of 0.001 and 0.01 for class compari-

son. A total of 4 microarray slides pairs were selected by

BRB for class comparison analysis. MDV (available from

LANL Oralgenhttp://www.oralgen.lanl.gov/) was used to

assign gene names and functional classes to identied

genes, as described previously (Klein et al. 2010). Genes

were then sorted in Microsoft Excel to identify those with

an absolute fold-change P1.6 (up-regulation), or 60.8

(down-regulation) compared to the vehicle control. The

transcriptome data were organized into the following

biological themes: EPS (genes involved in the production

of the biolm matrix), biolm/adhesion (genes involved

in the formation of the biolm that do not play a specic

role in matrix production), glycolytic pathways (genes

with known functions in sugar metabolism), stress (genes

with known functions in the stress response, includingoxidative stress and acid tolerance response), regulators

(genes with known regulatory functions), others (with

known biological functions but which have an unknown

role in the formation of a biolm/infection), and genes

encoding hypothetical proteins (genes lacking an identi-

ed function). Furthermore, the potency of the transcrip-

tional change was accounted for by sorting genes

according to the magnitude of their fold-change (treat-

ment/vehicle). cDNA microarray data have been depos-

ited in the NCBI Gene expression omnibus (GEO)

database (http://www.ncbi.nlm.nih.gov/geo) under GEO

accession number GSE40172.

Reverse transcription quantitative PCR (RT-qPCR)

RT-qPCR was performed to validate and verify further

the expression of specic genes selected from microarray

data analysis. cDNAs were synthesized from 1g of

puried RNA using a BioRad iScript cDNA synthesis

kit (Bio-Rad Laboratories, Inc., Hercules, CA). RNA

samples without reverse transcriptase were included as a

negative control. The resulting cDNA and negative con-

trols were amplied by a MyiQ qPCR detection system

with iQ SYBR Green supermix (Bio-Rad Laboratories,

Inc., CA, USA) and specic primers (Table 1). When

Taqman probes were available, cDNAs and controls were

amplied using a Bio-Rad CFX96 system (Bio-RadLaboratories). The 16S rRNA primers/TaqMan probes

were run separately, and primers/TaqMan probes for

other specic targets were combined and used in a multi-

plex setting. For reactions with only one TaqMan probe

(used for target 16S rRNA), the iQ Supermix (BioRad)

was used. For multiplex reactions (gtfB, gtfC, gtfD and

fruA and, dexA and ftf), the iQ Multiplex Powermix

(BioRad) was employed. Primer and TaqMan probes

sequences can be found in Table 1. Standard curves were

used to determine the relative number of cDNA mole-

cules, which were normalized to the relative number of

16S rRNA cDNA in each sample, as described previ-

ously (Yin et al. 2001). 16S rRNA served as a reference

gene (Klein et al. 2010). These values were used to

determine the fold-change between each treated sample

and the vehicle control. The MIQE guidelines (Bustin

et al. 2009) were followed for quality control of the data

generated and for data analysis.

Glucan-mediated bacterial adherence

The bacterial adherence assay was performed as described

previously (Koo et al. 2006). The HA surfaces were

632 G. Fenget al.
http://pfgrc.jcvi.org/index.php/microarray/array_description/Streptococcus_mutans/version3.htmlhttp://pfgrc.jcvi.org/index.php/microarray/array_description/Streptococcus_mutans/version3.htmlhttp://pfgrc.jcvi.org/index.php/microarray/protocols.htmlhttp://pfgrc.jcvi.org/index.php/microarray/protocols.htmlhttp://www.tm4.org/spotfinder.htmlhttp://www.tm4.org/spotfinder.htmlhttp://www.tm4.org/spotfinder.htmlhttp://www.tm4.org/spotfinder.htmlhttp://www.tm4.org/midas.htmlhttp://www.tm4.org/midas.htmlhttp://linus.nci.nih.gov/BRB-ArrayTools.htmlhttp://linus.nci.nih.gov/BRB-ArrayTools.htmlhttp://www.oralgen.lanl.gov/http://www.ncbi.nlm.nih.gov/geohttp://www.ncbi.nlm.nih.gov/geohttp://www.oralgen.lanl.gov/http://linus.nci.nih.gov/BRB-ArrayTools.htmlhttp://linus.nci.nih.gov/BRB-ArrayTools.htmlhttp://www.tm4.org/midas.htmlhttp://www.tm4.org/midas.htmlhttp://www.tm4.org/spotfinder.htmlhttp://www.tm4.org/spotfinder.htmlhttp://pfgrc.jcvi.org/index.php/microarray/protocols.htmlhttp://pfgrc.jcvi.org/index.php/microarray/protocols.htmlhttp://pfgrc.jcvi.org/index.php/microarray/array_description/Streptococcus_mutans/version3.htmlhttp://pfgrc.jcvi.org/index.php/microarray/array_description/Streptococcus_mutans/version3.html


6/13

coated with claried human saliva (sHA) and glucans

were formed in situ by surface-adsorbed GtfC in the pres-

ence of 100 mM sucrose (Koo et al. 2006) for 4 h. This

process ensures that sHA is completely coated with

glucans (glucan-coated sHA) as determined by scanning

electron and confocal uorescence microscopy. Cells of

S. mutans (1109 cells ml1) were then treated with the

aqueous extract of PAC or PAC molecules of DP 213,

washed and incubated with glucan-coated sHA (Koo et al.

2006). After incubation for 30 min, the beads were washed

and the number of adherent bacteria was determined with

scintillation counts (Schilling & Bowen 1992).

Statistical analyses

Exploratory analysis (EDA test) was performed to assess

the normality of the data sets. For microarray analysis,

pair-wise comparison was performed to test treatment vs

vehicle control. Type I error of p < 0.05 for one-way

analysis of variance was used to reject the null hypothe-

sis for biolm structural quantitation, RT-qPCR, and

adhesion assays. SAS version 9.2 (SAS Institute, Cary

NC) was used for all analyses.

Results and discussion

This study isolated A-type PACs of various DP classes

from a standardized single cranberry genotype, cultivar

Stevens, which has a high content of avonoids

(Vvedenskaya & Vorsa 2004). The Stevens variety has

also been characterized genetically (Polashock & Vorsa

2002; Fajardo et al. 2012) and the major avonoid

classes synthesized during fruit maturation determined

Table 1. Primers and TaqMan probes used for RT-qPCR.

GenBank ID Gene Primer sequence (forward and reverse)TaqMan probe sequence and dual-labeledprobes (reporters and quenchers) References

16S rRNA ACCAGAAAGGGACGGCTAAC CTAACGCAATAAGCACTCCGCCTGG Xiao et al. (2012)TAGCCTTTTACTCCAGACTTTCCTG 5 FAM/3 BHQ-1

SMU.1004 gtfB AAACAACCGAAGCTGATAC ATTGGCTGCATTGCTATCATCA

CAATTTCTTTTACATTGGGAAG 5 HEX/3 BHQ-1SMU.1005 gtfC CTCTGACTGCTACTGATACAAG AGCAACATCTCAACCAACCGCC

CCGAAGTTGTTGTTGGTTTAAC 5 Cal Fluor Red 610/3 BHQ-2SMU.910 gtfD AGCACAAACTTCTGAAGAGC CCTGTGCTTCTTCTGCTTGCTT

CAGCTTTTGCCTGTGTTAAAG 5 Quasar 670/3 BHQ-2SMU.2042c dexA TATTTTAGAGCAGGGCAATCG ACGCCAGTCATCCTCAACCGCA

AACCTCCAATAGCAGCATAAC 5 Quasar 705/3 BHQ-2SMU.78 fruA AACAACTGCTGCTGATACTG TCTGGCTGCTGTCTTCTGTTCT

CTGCGGTTTCTTGAGATGAC 5 FAM/3 BHQ-1SMU.2028c ftf CTGACATAACTACGCCAAAG CGCAATCTTACGAGCCTGTTCTGTT

TGCTTAAATTAATACCAGCTTC 5 HEX/3 BHQ-1

SMU.80 hrcA AATTAGGACTCTTAGAGAAGGC NA This studyAACATCCTGTTCGTCCAA

SMU.270 rmpC TTGGCTTCTTCTTCAATA NA

TAACCATCAAGGTAACTGSMU.148 adhE GCATCATTGGTGAAGATA NA

GTTAGTTGTTGGTACGATSMU.2109 mepA CTAGTGAGTGGACATTAG NA

CTAATAGGTGAGGCTTACSMU.671 citZ CAACGGTAAGTCTATTAGG NA

TAATGGTCGGTATCTTGGSMU.1396 gbpC CTAAGTATGGCGATCATG NA

ATATTGGTTGTCCTTAGCSMU.1933c sdcBB TCCTTGGATAGAATAGATAC NA

AAGGCTGATAAGTATACCSMU.629 sodA ATGACGCACTTGAACCATAT NA

CTGACGAATATCCGCTGG

SMU.562 clpE GCGACTATTCATCTATATGC NA Kajfasz et al. (2009)

GTCCATTTTCAGGATCTG

SMU.940 patB CTTGTCTTTCATCGGTGTTCATAC NA Falsetta et al. (2012)GGTCGCTCGTTTGATTGTTATTAC

Note: NA, not applicable. All oligonucleotides were designed using the Beacon designer program (Premier Biosoft, Palo Alto, CA), and were synthe-sized and supplied by Integrated DNA Technologies (Coralville, IA).

Biofouling 633


7/13

(Vvedenskaya & Vorsa 2004); enabling the timing of the

fruit harvest to maximize the extraction and isolation of

PACs. Such approaches eliminate the confounding

genetic variation that result in the chemical and bioactiv-

ity variation commonly associated with natural products

research, while helping to identify precisely the bioactive

molecules and the putative targets.

Topical applications of PACs affect biolm

accumulation and 3D architecture

The impact of a chemically characterized and puried

PACs-containing fraction on EPS-mediated biolm

assembly was examined. The clinical conditions of typi-

cal exposure of exogenously introduced therapeutic

agents in the mouth were simulated by applying the

extract topically twice daily for brief exposures (60s)

after the initial formation of the biolm (22 h). The typi-

cal architecture of the biolm prior to treatment (22 h) is

shown in Figure S1. [Supplementary material is available

via a multimedia link on the online article webpage.]The biomass and thickness of both the EPS (red) and

adherent bacteria (green) in biolms treated with PACs

were signicantly less than in vehicle-treated biolms

(Table 2), which resulted in defective accumulation of

the biolm and altered the 3D architecture (Figure 2).

Confocal images revealed a marked (albeit not com-

plete) impairment of EPS-matrix development (Figure 2),

which contained approximately 3.5 times less EPS with

reduced thickness vs vehicle-treated biolms (Table 2).

The data agree well with effective inhibition of glucan

synthesis by surface-adsorbed GtfB and GtfC by cran-

berry PACs (Duarte et al. 2006). Such effects can inu-

ence the pattern of bacterial binding and accumulation toa great extent. Glucans produced on the pellicle by sur-

face-adsorbed GtfC promote the initial adhesion of bacte-

ria while the polymers formed by GtfB bound to the

bacterial surface helps further aggregation, forming cohe-

sive microcolonies (Xiao et al. 2012). This sucrose-

dependent mechanism is highly favorable for S. mutans

as this bacterium expresses multiple glucan-binding

proteins (Sato et al. 1997; Lynch et al. 2007).

The uorescence images show that the formation and

further accumulation of new microcolonies (green) were

disrupted following treatment with PACs (vs vehicle

control), probably as a result of a reduction in the

synthesis of EPS in situ. The deletion of both gtfB and

gtfC in S. mutans completely impaired the ability of the

mutant strain to assemble microcolonies even in the

presence of sucrose (Xiao et al. 2012). However, it is

possible that bacterial adhesion to EPS may be impaired

as large areas of EPS were devoid of any attached cellsor cell clusters (Figure 2).

The development of microcolonies enmeshed in the

EPS is critical for the expression of biolm virulence.

These structures act as diffusion-limiting barriers facili-

tating the creation of highly acidic microenvironments at

the attachment surface (Xiao et al. 2012), which may

promote demineralization of the adjacent tooth-enamel.

The few sparsely distributed microcolonies remaining in

the biolms treated with PACs appear to be larger (with

a higher EPS to bacteria ratio) than those in the

vehicle-treated biolms (and vs biolms pre-treated at

22 h; Figure S1), suggesting that microcolony develop-

ment was not completely inhibited. However, it is alsoapparent that there is much less EPS surrounding these

microcolonies, particularly in the outer layers (Figure 2).

Such biolm architecture, with large areas devoid of

microcolonies, would be less capable of maintaining an

acidic pH at the attachment surface (Xiao et al. 2012).

Whether the remaining microcolonies can cause enamel

demineralization awaits further evaluation.

Previous studies have shown that extracts containing

PACs have no effect on the growth and viability of

S. mutans (Koo, Duarte, et al. 2010) and Candida

albicans (Feldman et al. 2012). However, it is possible

that PACs could affect the expression of EPS synthesiz-

ing Gtfs or the EPS-mediated bacterial adhesion factors,which are critical for the assembly of microcolonies.

Gene expression byS. mutans within biolms post

treatment with PACs

Microarrays and multiplex RT-qPCR were used to charac-

terize how topical application of PACs inuences the S.

mutans transcriptome within the biolm. RT-qPCR was

necessary to assess the transcriptional proles of EPS-

associated genes (gtfBCD, ftf, dexA, and fruA), as micro-

arrays have low condence at detecting mRNA levels,

particularly if genes are repressed (Klein et al. 2010). One

Table 2. Biomass and average thickness values of bacterial cells and EPS in PACs-treated biolms.

Treatment

Biomass (m3 m2) Average thickness (m)

Bacteria EPS Bacteria EPS

Vehicle control 28.93 3.61a 68.18 7.92a 98.93 13.3a 101.2 10.53a

PACs 4.31 2.68b 19.88 7.23b 5.89 3.98b 20.82 8.51b

Note: Biolms were treated topically with vehicle control and PACs-containing fraction. Values labeled with a different letter in each column are statis-tically different (p < 0.0001,n = 3).

634 G. Fenget al.


8/13

Figure 2. Representative 3D rendered images of biolms of S. mutans following topical treatment with the vehicle control (A), andwith the cranberry PACs-containing fraction (B). The EPS channel is in red, bacterial cells are in green. Scale bars = 100m.

Biofouling 635


9/13

hundred and nineteen genes whose expression was differ-

entially regulated in response to PACs were detected. To

evaluate the data generated from microarray and RT-qPCR

analyses, genes were organized into categories relevant to

the formation of biolms of S. mutans, tness and viru-

lence expression (see Materials and methods).

On balance there were far more repressed thaninduced genes (Figure 3), suggesting that upon exposure

to cranberry PACs, genes associated with many cellular

activities during biolm development were down-regu-

lated rather than up-regulated. The expression levels of

selected genes detected by microarray analysis were vali-

dated by RT-qPCR (Table 3). The microarray data

showed that a large number of genes affected by PACs

have an unknown function related to the formation of

biolm or expression of virulence. It is currently being

investigated whether these genes have any signicant

role in the development of biolms of S. mutans. For

example, patB (SMU.940) expression was highly affected

following treatment with PACs. Recently, a knockoutmutant of patB from S. mutans UA159 has been gener-

ated; initial analysis suggests that the gene deletion does

not cause a defect in growth, but that the formation of

biolm is reduced in the mutant strain with reduced

amounts of EPS (vs the parental strain) (Falsetta et al.

2012). Although further characterization is needed, it

appears that patB may be involved with EPS synthesis

during the formation of a biolm. It is possible thatpatB

may be induced to compensate for the lack of EPS in

the biolms treated with PACs.

PACs affects expression of sucrose-dependent adhesionfactors but not the expression of EPS-related enzymes

The EPS (glucans) produced from sucrose by Gtfs, pres-

ent on tooth pellicle and bacterial surfaces, act as bind-

ing sites (Schilling & Bowen 1992) promoting specic

and enhanced adhesion by S. mutans through membrane-

associated glucan-binding proteins and other co-factors

(Banas & Vickerman 2003). This study examined

whether PACs disrupt the transcription of relevant genes

associated with these sucrose-dependent processes.

The data show that a major group of sucrose-depen-

dent adhesion factors are repressed after treatment with

PACs (Table 3). These factors include gbpC, rmpC,mepA and sdcBB, which play important roles in bacterial

adherence and subsequent formation of biolms of

S. mutans in the presence of sucrose. The gene gbpC

encodes glucan-binding protein C which has been identi-

Table 3. Selected genes from PACs-treated biolms revealed as being differentially expressed (vs vehicle control) by microarrayanalysis.

GenBank ID Gene Functional category Microarray RT-qPCR

SMU.1396 gbpC Biolm/adhesion 0.81 0.83

SMU.270 rmpC Biolm/adhesion 0.68 0.64

SMU.2109 mepA Biolm/adhesion 0.72 0.70

SMU.1933c sdcBB Biolm/adhesion 0.74 0.69

SMU.148 adhE Glycolytic pathway 0.7 0.72

SMU.671 citZ Glycolytic pathway 0.67 0.75

SMU.80 hrcA Stress (acid) 0.76 0.89SMU.629 sodA Stress (oxidative) 1.6 1.56

SMU.562 clpE Stress (acid) 1.75 1.56

SMU.940 patB Other 1.7 2.78

Note: These genes were selected for RT-qPCR validation. Biolms were treated topically with vehicle control and PACs-containing fraction. Valuesmarked with an asterisk () are signicantly different from biolms treated with vehicle control (p < 0.05,n =3).

Figure 3. Functional categories affected by treatment with PACs. Number of repressed (left panel) and induced (right panel) genesofS. mutans in biolms exposed to PACs-containing fraction (n = 4). Genes are grouped into specic functional categories (biologicalthemes) as listed in the center of the graph. Genes whose fold of change in expression was 60.8 orP1.6 (p < 0.05) are included.

636 G. Fenget al.


10/13

ed as a critical contributor to the development of bio-

lms of S. mutans and the maintenance of 3D biolm

architecture (Sato et al. 1997; Lynch et al. 2007). MepA,

rmpC, and sdcBB were identied as membrane-associ-

ated sucrose-dependent adhesion factors in addition to

the Gbp family (Tao & Tanzer 2002). Insertional inacti-

vation of these genes resulted in a de

ciency in bacterialadhesion in vitro and colonization of tooth surface

in vivo in the presence of sucrose, despite normal Gtf

production and activity. This is the rst report showing

the molecular impact of cranberry PACs on the expres-

sion of biolm-related adhesion factors by S. mutans.

In contrast, this study did not nd signicant

differences in the expression of genes associated with

EPS synthesis (gtfBCD and ftf) and degradation (dexA

and fruA) between the vehicle control and PACs treat-

ments (Figure S2). Therefore, the overall reduction of

EPS synthesis may be due primarily to inhibitory effects

of the PACs directly on the enzymatic activity of GtfB

and GtfC as reported by previous studies (Duarte et al.2006; Gregoire et al. 2007; Koo, Duarte, et al. 2010)

and not the repression of transcription.

The extracellular effects on glucan synthesis com-

bined with transcriptional repression of sucrose-mediated

adhesion provide a fundamental interpretation of previ-

ous data showing that crude extracts of cranberry reduce

bacterial adherence to glucan-coated apatitic surfaces

and formation of biolms without antibacterial activity

(Duarte et al. 2006; Koo et al. 2006; Gregoire et al.

2007; Koo, Duarte, et al. 2010).

PACs affects expression of other relevant genes

associated with the virulence of biolmsAnother group of repressed genes were identied, that

are linked with glycolysis and the acid stress response in

S. mutans (Table 3). The expression of adhE and citZ

was down-regulated by the PACs fraction. The genes

ahdE and citZ encode alcohol-acetaldehyde dehydroge-

nase and citrate synthase, which are important metabo-

lism-related enzymes in the glycolytic pathways. AdhE

catalyzes the reaction of converting acetyl-CoA to etha-

nol and CoA (Kessler et al. 1992). The cit operon

encodes proteins for the citrate pathway and for the syn-

thesis of the glutamate in minimal medium where the

organic nitrogen source is limited (Cvitkovitch et al.

1997). The gene citZ was also found to be a stress-

responsive gene to osmolarity (Chia et al. 2001). The

gene hrcA also appears to be repressed after exposure to

the PACs fraction (albeit it was not conrmed via

RT-qPCR). HrcA is a transcriptional regulator of dnaK

and groE, which encode important chaperones that play

critical roles in helping S. mutans to cope with acidic

stress (Jayaraman et al. 1997; Lemos et al. 2001, 2007).

Conversely, clpEand sodAwere induced by treatment

with the PACs. ClpE belongs to the Clp system which

consists of proteases for degrading or chaperoning incor-

rectly folded proteins under acidic conditions (Kajfasz

et al. 2009). Gene sodA encodes superoxide dismutase

which provides protection against oxidative stress (Nakay-

ama 1992). The up-regulation of these genes may suggest

mobilization of some of the stress response factors in

order for the cells in the bio

lms treated with PACs, whichare less protected by EPS, to cope with environmental

stresses. Collectively, these transcriptional changes may

explain why treatment with PACs reduced (albeit moder-

ately) the acid production and acid tolerance of biolms of

S. mutans(Duarte et al. 2006; Gregoire et al. 2007).

Bioactivity of isolated cranberry PACs with varying DP

The major disruptive effects caused by topical applica-

tions of cranberry PACs fraction appear to be on the

assembly of the EPS-matrix and EPS-mediated processes

involved in the adhesion of S. mutans and the develop-

ment of a biolm. Several sucrose-dependent adhesion

factors were repressed following topical exposure toPACs. However, the cranberry PACs contained in the

fraction are a mixture of molecules with variable DP.

The PACs range in DP from 2 to 13 epicatechin units.

Therefore, the individual bioactivity and the role of the

DP on S. mutans binding to glucan-coated surfaces and

on gene expression in biolms were assessed.

Glucan-mediated bacterial adhesion

The inuence of compounds of varying DP on bacterial

binding to glucan-coated apatitic surfaces was investi-

gated. Specic PAC oligomers with DP >8 were potent

Figure 4. The adhesion of cells of S. mutans to a glucan-coated apatitic surface. Bacterial cells were treated withisolated PAC molecules of DP 213. The percentage binding ofbacteria was calculated relative to vehicle control treated cells(control= 100%). Values with 3 and 4 asterisks are signicantlydifferent from the control at a level ofp < 0.001 andp < 0.0001,respectively (n = 3). All the values among different DPs aresignicantly different from each other (p < 0.05), exceptbetween DP 89 and DP 1213 (p > 0.05).

Biofouling 637


11/13

inhibitors of the adhesion of S. mutans (as high as 85%

inhibition, Figure 4). Generally, the bioactivity of PACs

increase with higher numbers of epicatechin units in the

molecule, but this relationship is not linear. There is an

increased effectiveness from DP 2 to 4 and DP 5 to DP

13. However, a clear distinction in bioactivity was

observed for molecules of higher DP (DP >8) whencompared to smaller oligomers (DP 2 to DP4) (Figure 4).

The inhibitory activity from highest to lowest effect (vs

vehicle control) was DP 1011 (85.9%, percentage of

inhibition), DP 89 (65.7%), DP 1213 (58.3%), DP 4

(28.7%), and DP 3 (15.7%). None of the isolated PACs

caused bacterial aggregation (as observed under phase-

contrast microscope) and precipitation.

The failure of DP 56 to inhibit adhesion is particu-

larly intriguing, especially considering the overall trend

of increased effectiveness with higher DP. Oligomers can

exist in various conformations as to whether units are

linked by C(4)C(8) vs C(4)C(6) bonds, and the loca-

tion of the double A-type linkage. Additional studiesshall identify the linkages of DP 56 oligomers relative

to those of DP 34 and DP >6 to determine potential

differences in the structure/conformation of these DP

classes, which could be linked with bioactivity.

Gene expression

The genes rmpC and hrcA were selected based on the

microarray analysis, and relevance to sucrose-dependent

biolm formation and aciduricity (Jayaraman et al. 1997;

Tao & Tanzer 2002). The results from RT-qPCR analysis

followed a similar trend of inhibition as observed with

bacterial adhesion assays. There is trend of increasedeffectiveness between DP 2 and 4, and from DP 5 to 13

(albeit mostly incremental) (Figure 5). For the PACs with

a DP ranging from 2 to 4 epicatechin units, the reduction

in the expression of rmpC and hrcA appeared to be

correlated with increasing DP, with DP 4 being the most

effective (Figure 5). The PACs with a DP 5 to 1011 dis-

played similar activities. There was a signicant increase

in repression following treatment with the DP 1213

class. The expression prole of these two genes indicated

that DP 4 and DP 1213 were the most effective cran-

berry PACs in modulating the expression of selected

genes ofS. mutans in biolms. It is also apparent that the

specic isolated PACs are more active than the PACsfraction in disrupting the gene expression of S. mutans

(particularly hrcA). The extract contains a mixture of

active and less-active PACs, which may affect the overall

bioactivity (vs individual compounds). In addition, the

isolated PACs were devoid of any signicant effects on

the viability of cells ofS. mutansin biolms (Figure S3).

Collectively, the data show some evidence of the

structure-activity relationship of cranberry PAC mole-

cules. There is a trend of increased bioactivity with

higher DP (number of epicatechin units), particularly in

glucan-mediated bacterial adhesion. But this relationship

appears to be present in two DP ranges: DP 2 to 4 and

DP 5 to 13. In each range, DP 4 and DP 1213 (or DP

1011 for adhesion assay) were the most effective mole-

cules. PACs are well recognized for their interactions

with proteins (Bennick 2002; Jobstl et al. 2004). Procy-

anidin dimers linked through a C(4)C(8) interavanoid

bond were reported to have greater tannin specic bind-

ing activity than dimers with C(4)C(6) linkage (de

Freitas & Mateus 2001). Besides having the A-type

interavanoid linkage, cranberry trimers were all identi-

ed to have the C(4)C(8) linkage (Foo et al. 2000b).

Larger and more complex polyphenols (DP >8) interact

more strongly and have greater protein-binding activity

than smaller oligomers (Baxter et al. 1997).It is plausible that the oligomers of differing DP in

this study exert their effect by more than one mecha-

nism. The effect on adhesion could be an outcome of the

effect on gene expression as well as the direct interaction

of PACs with glucan-producing enzymes (Gtfs) and with

glucan-binding proteins associated with the surface of

S. mutans (Gbps). The DP 34 classes may exert most

of the activity on gene expression, whereas DP >8

involves direct proteinPAC interactions. It is possible

Figure 5. The expression of S. mutans genes rmpC and hrcAin biolms treated topically with isolated PAC molecules of DP2 to 13. The values marked with 1, 2, 3, and 4 asterisks aresignicantly different from the control at a level of p < 0.05,p < 0.01, p < 0.001, and p < 0.0001, respectively. For rmpC, thevalue for DP 2 is signicantly different from all others at a

level of p < 0.05. The values for DP 3, DP 4, DP 5

6, DP 8

9and DP 1011 are signicantly different from DP 2 and DP1213 (p < 0.05) but not from each other (p > 0.05). The valuefor DP 1213 is signicantly different from all others at a levelof p < 0.05. For hrcA, the value for DP 2 is signicantlydifferent from DP 3, DP 4, and DP 1213 (p < 0.05). The valuefor DP 3 is signicantly different from DP2 to DP 1213(p < 0.05). The value for DP 4 is signicantly different fromDP 2, DP 56, DP 89, DP 1011 and DP 1213 (p < 0.05).The values for DP 56, DP 89, and DP 1011 aresignicantly different from DP 2, DP 4, and DP 1213(p < 0.05) but not from DP 3 or from each other (p > 0.05).

638 G. Fenget al.


12/13

that the reduced effect on adhesion with the DP 56

class is that it has lesser impact on both of these mecha-

nisms. The exact reason why these compounds have

such a structure-activity relationship is unclear. It could

be a result of the interplay between the DP with other

factors, including the molecular structure itself (eg the

position of A-type double linkage), the location of C(4)

C(6)/C(4)(8) linkages and the size of the molecules,

which may cause strong steric hindrance. How these fac-

tors interact with each other and inuence bioactivity

needs to be investigated in future studies.

Overall, the mechanisms of action by which topical

applications of fractions containing A-type PACs disrupt

the accumulation of biolms are intriguing, as the expres-

sion of several sucrose-dependent bacterial adhesion fac-

tors were repressed while those associated with EPS-

synthesis were unaffected. However, PACs can inhibit

the activity of EPS-producing enzymes extracellularly

(Duarte et al. 2006; Koo, Duarte, et al. 2010). Further-

more, the expression of specic genes associated withacid stress and glycolysis was also repressed. Further

analysis with puried compounds revealed that oligomers

with DP 4 and DP 8 to 13 were the most active in dis-

rupting EPS (glucan)-mediated bacterial adhesion and

gene expression, while dimers and those with DP 56

were generally inactive. The identication of the com-

pounds of highest bioactivity could facilitate the effective

design of anti-biolm therapies based on cranberry PACs,

while providing the basis for additional structure-activity

studies to further elucidate the mechanisms of action of

these promising non-bacteriocidal biolm inhibitors.

AcknowledgmentsThis work was supported by a NIH grant (5R01DE016139).The authors thank the Multiphoton Core Facility of theUniversity of Rochester Medical Center, for their technicalassistance. A.P.S. and N.V. are thankful to Sneha Shah andSusan Butterworth for their help in isolation of PACs.

References

Ajdic D, McShan WM, McLaughlin RE, Savic G, Chang J,Carson MB, Primeaux C, Tian R, Kenton S, Jia H, et al.2002. Genome sequence of Streptococcus mutans UA159,a cariogenic dental pathogen. Proc Natl Acad Sci USA.99:1443414439.

Banas JA, Vickerman MM. 2003. Glucan-binding proteins of

the oral streptococci. Crit Rev Oral Biol Med. 14:89

99.Baxter NJ, Lilley TH, Haslam E, Williamson MP. 1997. Multi-

ple interactions between polyphenols and a salivary pro-line-rich protein repeat result in complexation andprecipitation. Biochemistry. 36:55665577.

Bennick A. 2002. Interaction of plant polyphenols with salivaryproteins. Crit Rev Oral Biol Med. 13:184196.

Burger O, Ofek I, Tabak M, Weiss EI, Sharon N, Neeman I.2000. A high molecular mass constituent of cranberry juiceinhibits Helicobacter pylori adhesion to human gastricmucus. FEMS Immunol Med Microbiol. 29:295301.

Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubi-sta M, Mueller R, Nolan T, Pfaf MW, Shipley GL, et al.2009. The MIQE guidelines: minimum information forpublication of quantitative real-time PCR experiments. ClinChem. 55:611622.

Chia JS, Lee YY, Huang PT, Chen JY. 2001. Identication ofstress-responsive genes in Streptococcus mutans by differ-ential display reverse transcription-PCR. Infect Immun.69:24932501.

Cote J, Caillet S, Doyon G, Sylvain JF, Lacroix M. 2010.Bioactive compounds in cranberries and their biologicalproperties. Crit Rev Food Sci Nutr. 50:666679.

Cury JA, Koo H. 2007. Extraction and purication of totalRNA from Streptococcus mutans biolms. Anal Biochem.365:208214.

Cvitkovitch DG, Gutierrez JA, Bleiweis AS. 1997. Role of thecitrate pathway in glutamate biosynthesis by Streptococcusmutans. J Bacteriol. 179:650655.

de Freitas V, Mateus N. 2001. Structural features of procyani-din interactions with salivary proteins. J Agric Food Chem.49:940945.

Duarte S, Gregoire S, Singh AP, Vorsa N, Schaich K,Bowen WH, Koo H. 2006. Inhibitory effects of cran-

berry polyphenols on formation and acidogenicity ofStreptococcus mutans biolms. FEMS Microbiol Lett.257:5056.

Fajardo D, Morales J, Zhu H, Steffan S, Harbut R, Bassil N,Hummer K, Polashock J, Vorsa N, Zalapa J. 2012.Discrimination of American cranberry cultivars andassessment of clonal heterogeneity using microsatellitemarkers. Plant Mol Biol Rep. 31:264271.

Falsetta ML, Klein MI, Lemos JA, Silva BB, Agidi S,Scott-Anne KK, Koo H. 2012. Novel antibiolmchemotherapy targets exopolysaccharide synthesis andstress tolerance in Streptococcus mutans to modulatevirulence expression in vivo. Antimicrob AgentsChemother. 56:62016211.

Feldman M, Tanabe S, Howell A, Grenier D. 2012. Cranberry

proanthocyanidins inhibit the adherence properties of Can-dida albicans and cytokine secretion by oral epithelialcells. BMC Complement Altern Med. 12:6.

Flemming HC, Wingender J. 2010. The biolm matrix. NatRev Microbiol. 8:623633.

Foo LY, Lu Y, Howell AB, Vorsa N. 2000a. A-type proantho-cyanidin trimers from cranberry that inhibit adherence ofuropathogenic P-mbriated Escherichia coli. J Nat Prod.63:12251228.

Foo LY, Lu Y, Howell AB, Vorsa N. 2000b. The structure ofcranberry proanthocyanidins which inhibit adherence ofuropathogenic P-mbriated Escherichia coli in vitro.Phytochemistry. 54:173181.

Gregoire S, Singh AP, Vorsa N, Koo H. 2007. Inuence ofcranberry phenolics on glucan synthesis by glucosyltransfe-rases and Streptococcus mutans acidogenicity. J ApplMicrobiol. 103:19601968.

Gregoire S, Xiao J, Silva BB, Gonzalez I, Agidi PS, Klein MI,Ambatipudi KS, Rosalen PL, Bauserman R, Waugh RE,et al. 2011. Role of glucosyltransferase B in interactions ofCandida albicans with Streptococcus mutans and with anexperimental pellicle on hydroxyapatite surfaces. ApplEnviron Microbiol. 77:63576367.

Hall-Stoodley L, Costerton JW, Stoodley P. 2004. Bacterialbiolms: from the natural environment to infectiousdiseases. Nat Rev Microbiol. 2:95108.

Biofouling 639


13/13

Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M,Ersboll BK, Molin S. 2000. Quantication of biolmstructures by the novel computer program COMSTAT.Microbiology. 146:23952407.

Howell AB, Reed JD, Krueger CG, Winterbottom R, Cunning-ham DG, Leahy M. 2005. A-type cranberry proanthocyani-dins and uropathogenic bacterial anti-adhesion activity.Phytochemistry. 66:22812291.

Howell AB, Vorsa N, Der Marderosian A, Foo LY. 1998.Inhibition of the adherence of P-mbriatedEscherichia colito uroepithelial-cell surfaces by proanthocyanidin extractsfrom cranberries. N Engl J Med. 339:10851086.

Jayaraman GC, Penders JE, Burne RA. 1997. Transcriptionalanalysis of the Streptococcus mutans hrcA, grpE and dnaKgenes and regulation of expression in response to heat shockand environmental acidication. Mol Microbiol. 25:329341.

Jobstl E, OConnell J, Fairclough JP, Williamson MP. 2004.Molecular model for astringency produced by polyphenol/protein interactions. Biomacromolecules. 5:942949.

Kajfasz JK, Martinez AR, Rivera-Ramos I, Abranches J, KooH, Quivey RG, Jr, Lemos JA. 2009. Role of clp proteins inexpression of virulence properties ofStreptococcus mutans.J Bacteriol. 191:20602068.

Kessler D, Herth W, Knappe J. 1992. Ultrastructure and pyru-vate formate-lyase radical quenching property of the multi-enzymic AdhE protein of Escherichia coli. J Biol Chem.267:1807318079.

Klein MI, DeBaz L, Agidi S, Lee H, Xie G, Lin AH, HamakerBR, Lemos JA, Koo H. 2010. Dynamics of Streptococcusmutans transcriptome in response to starch and sucroseduring biolm development. PLoS ONE. 5:e13478.

Klein MI, Xiao J, Lu B, Delahunty CM, Yates 3rd JR, Koo H.2012. Streptococcus mutans protein synthesis duringmixed-species biolm development by high-throughputquantitative proteomics. PLoS ONE. 7:e45795.

Koo H, Duarte S, Murata RM, Scott-Anne K, Gregoire S, Wat-son GE, Singh AP, Vorsa N. 2010. Inuence of cranberryproanthocyanidins on formation of biolms by Streptococ-

cus mutans on saliva-coated apatitic surface and on dentalcaries developmentin vivo. Caries Res. 44:116126.

Koo H, Nino de Guzman P, Schobel BD, Vacca Smith AV,Bowen WH. 2006. Inuence of cranberry juice onglucan-mediated processes involved in Streptococcusmutans biolm development. Caries Res. 40:2027.

Koo H, Xiao J, Klein MI, Jeon JG. 2010. Exopolysaccharidesproduced by Streptococcus mutans glucosyltransferasesmodulate the establishment of microcolonies within multi-species biolms. J Bacteriol. 192:30243032.

Lemos JA, Chen YY, Burne RA. 2001. Genetic and physio-logic analysis of the groE operon and role of the HrcArepressor in stress gene regulation and acid tolerance inStreptococcus mutans. J Bacteriol. 183:60746084.

Lemos JA, Luzardo Y, Burne RA. 2007. Physiologic effects offorced down-regulation of dnaK and groEL expression inStreptococcus mutans. J Bacteriol. 189:15821588.

Lewis K. 2001. Riddle of biolm resistance. AntimicrobAgents Chemother. 45:9991007.

Liu Y, Black MA, Caron L, Camesano TA. 2006. Role of cran-berry juice on molecular-scale surface characteristics andadhesion behavior of Escherichia coli. Biotechnol Bioeng.93:297305.

Lynch DJ, Fountain TL, Mazurkiewicz JE, Banas JA. 2007.Glucan-binding proteins are essential for shaping Strepto-coccus mutans biolm architecture. FEMS Microbiol Lett.268:158165.

Marsh PD. 2003. Are dental diseases examples of ecologicalcatastrophes? Microbiology. 149:279294.

Nakayama K. 1992. Nucleotide sequence of Streptococcusmutans superoxide dismutase gene and isolation ofinsertion mutants. J Bacteriol. 174:49284934.

OMay C, Tufenkji N. 2011. The swarming motility of Pseudo-monas aeruginosa is blocked by cranberry proanthocyani-dins and other tannin-containing materials. Appl EnvironMicrobiol. 77:30613067.

OToole G, Kaplan HB, Kolter R. 2000. Biolm formation asmicrobial development. Annu Rev Microbiol. 54:4979.

Paes Leme AF, Koo H, Bellato CM, Bedi G, Cury JA. 2006.The role of sucrose in cariogenic dental biolm formationnew insight. J Dent Res. 85:878887.

Polashock J, Vorsa N. 2002. Development of SCAR markersfor DNA ngerprinting and germplasm analysis ofAmerican cranberry. J Am Soc Hort Sci. 127:677684.

Sato Y, Yamamoto Y, Kizaki H. 1997. Cloning andsequence analysis of the gbpC gene encoding a novelglucan-binding protein of Streptococcus mutans. InfectImmun. 65:668675.

Schilling KM, Bowen WH. 1992. Glucans synthesized in situin experimental salivary pellicle function as specic

binding sites for Streptococcus mutans. Infect Immun.60:284295.

Schmidt BM, Ribnicky DM, Lipsky PE, Raskin I. 2007.Revisiting the ancient concept of botanical therapeutics.Nat Chem Biol. 3:360366.

Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M,Gassmann M, Lightfoot S, Menzel W, Granzow M, Ragg T.2006. The RIN: an RNA integrity number for assigningintegrity values to RNA measurements. BMC Mol Biol. 7:3.

Singh AP, Singh RK, Kim KK, Satyan KS, Nussbaum R,Torres M, Brard L, Vorsa N. 2009. Cranberry proanthocy-anidins are cytotoxic to human cancer cells and sensitizeplatinum-resistant ovarian cancer cells to paraplatin.Phytother Res. 23:10661074.

Stewart PS, Franklin MJ. 2008. Physiological heterogeneity in

biolms. Nat Rev Microbiol. 6:199

210.Tao L, Tanzer JM. 2002. Novel sucrose-dependent adhesion

co-factors in Streptococcus mutans. J Dent Res.81:505510.

Vacca-Smith AM, Bowen WH. 1998. Binding properties ofstreptococcal glucosyltransferases for hydroxyapatite,saliva-coated hydroxyapatite, and bacterial surfaces. ArchOral Biol. 43:103110.

Vvedenskaya I, Vorsa N. 2004. Flavonoid compositionover fruit development and maturation in Americancranberry, Vaccinium macrocarpon ait. Plant Sci.167:10431054.

Xiao J, Klein MI, Falsetta ML, Lu B, Delahunty CM, Yates3rd JR, Heydorn A, Koo H. 2012. The exopolysaccharidematrix modulates the interaction between 3D architectureand virulence of a mixed-species oral biolm. PLoSPathog. 8:e1002623.

Yanagida A, Kanda T, Tanabe M, Matsudaira F, OliveiraCordeiro JG. 2000. Inhibitory effects of apple polyphenolsand related compounds on cariogenic factors of mutansstreptococci. J Agric Food Chem. 48:56665671.

Yin JL, Shackel NA, Zekry A, McGuinness PH, Richards C,Putten KV, McCaughan GW, Eris JM, Bishop GA. 2001.Real-time reverse transcriptase-polymerase chain reaction(RT-PCR) for measurement of cytokine and growth factormRNA expression with uorogenic probes or SYBR green.Immunol Cell Biol. 79:213221.

640 G. Fenget al.

Pac Cranberri

Documents

Transcript of Pac Cranberri