Seminario Técnico Compuestos azufrados volátiles en vinos · Seminario Técnico Compuestos...

Seminario Técnico

Compuestos azufradosvolátiles en vinosProblemas de reduccióny aromas varietales

Organizan:

Colaboran:

Tarragona, 23 de abril de 2009Madrid, 24 de abril de 2009

Índice

Ponencias4 01. Relación entre el contenido nitrogenado

en mosto/uva y la síntesis de aromas: efecto

sobre la producción de sulfhídricoProf. Gemma Beltran Universidad Rovira i Virgili

Prof. Jose Manuel GuillaMón Universidad Rovira i Virgili Instituto de Agroquímica y Tecnología de Ali-mentos IATA-CSIC

18 02. Los nuevos retos en microbiología del

vino. Levaduras no productoras de SH2

isak S. PretoriusThe Australian Wine Research Institute, PO Box 197, Glen Osmond, Adelaide, SA 5064, Australia

30 03. La micro-oxigenación de vinos tintos:

Control de la reducción y estabilización del

colorProf. encarna Gómez PlazaUniversidad de Murcia

36 04. ¡Los compuestos volátiles no son todos

perjudiciales! rémi Guerin-SCHneiDerInstitut Français de la Vigne et du Vin ENTAV-ITV France

Artículos relacionados41 Influence of the Timing of Nitrogen Additions

during Synthetic Grape Must Fermentations

on Fermentation Kinetics and Nitrogen

Consumption

51 Formación de compuestos volátiles azufrados

por levaduras vinicas.

59 Una revolución en el sector enólogico:

59 Levaduras de vinificación que no producen

Sulfuro de hidrógeno (H2S)

63 Nitrogen management is critical for wine

Managing Director, flavour and style

73 Unravelling the genetic blueprint of wine yeast

77 When the heat is on, yeast fermentation runs

out of puff

83 Taking control of alcohol

87 A la recerca del codi digital dels llevats del vi

91 Effect of Micro-oxygenation on Color and

Anthocyanin-Related Compounds of Wines

with Different Phenolic Contents

103 Efectos de la microoxigenación en vino tinto

3

Contenido6 Resumen

6 1. Introducción

7 2. Efecto de la concentración y tipo de

nitrógeno sobre el crecimiento de las

levaduras y su cinética fermentativa.

9 3. Efecto de la concentración y tipo de

nitrógeno sobre la cinética fermentativa

10 4. Relación entre el contenido en nitrógeno y

la síntesis de compuestos aromáticos

15 Bibliografía

01. Relación entre el contenido nitrogenado en mosto/uva y la síntesis de aromas: efecto sobre la producción de sulfhídrico

Prof. Gemma BeltRanUniversidad Rovira i Virgili

Prof. Jose Manuel GUillaMónUniversidad Rovira i Virgili instituto de agroquímica y tecnología de alimentos iata-CSiC

Seminario técnico

Compuestos azufrados volátiles en vinos

José M. Guillamón navarroRequena, 6 de julio de 1967. e-mail: [email protected]

investigación:Coautor de 50 artículos científicos en revistas interna-cionales de las áreas de Tecnología de Alimentos, Bio-tecnología y Microbiología. Coautor de 20 artículos en revistas de divulgación del sector agroalimentario y vi-tivinícola. 80 comunicaciones a Congresos nacionales e internacionales, 24 de ellas como ponente invitado o comunicación oral. Autor de 5 capítulos de libros espe-cializados y 37 capítulos en libros de congresos. Autor de 3 patentes de levaduras vínicas en explotación. Di-rector de 3 tesis doctorales (2 de ellas con formato de doctorado europeo)

líneas de investigación• Estudio del metabolismo de las levaduras en

condicionesdefermentaciónvínica.Efectodelasbajas temperaturas de fermentación y del meta-bolismo del nitrógeno.

• Estudiodelaspoblacionesdelevadurasybacte-rias acéticas durante los procesos de elaboración de vino. Utilización de marcadores moleculares para la caracterización e identificación de los mi-croorganismos del vino.

estancias en Centros extranjeros:• Estanciapost-doctoralenlaUniversidaddeUtre-

cht (junio del 1998 a mayo del 1999).

• Estancia post-doctoral en el “Institute forWineBiotechnology (Stellenbosch University)” en Stellenbosch (Sudáfrica) (septiembre del 2004 a marzo del 2005).

Gemma Beltran Casellas31 de octubre de 1975

Posición actual:• ProfesoraayudantedoctordelDepartamentode

Bioquímica y Biotecnología de la Universidad Ro-viraiVirgili,FacultaddeEnología,desdediciem-bre del 2007.

• Miembrodelgrupode investigacióndeBiotec-nologíaEnológicadelaFacultaddeEnologíadela URV, dentro de la línea de estudio de las leva-duras vínicas.

A lo largo de su carrera investigadora Gemma Beltran ha colaborado en proyectos sobre el estudio las leva-duras y sus requerimientos nutricionales, analizando los factores que pueden condicionar a una mejora en la fermentación alcohólica, tanto los que se derivan del mosto (niveles de nitrógeno disponible) como de varias prácticas enológicas (fermentaciones a bajas temperaturas, rehidratación). Sus investigaciones pre-doctorales se centraron principalmente en el estudio la represión catabólica por nitrógeno a lo largo de la fermentación (Beltran et. al. 2004, 2005), así cómo en el efecto de las bajas temperaturas de fermentación sobre los cambios en la expresión génica global y el metabolismo de la levadura vínica (Beltran et al. 2006, 2007, 2008). Además, en su estancia post-doctoral rea-lizada en el grupo de Biología Molecular de levaduras del profesor Stefan Hohmann (Suecia), estuvo invo-lucrada en estudios de señalización de nutrientes, en concreto estudiando el metabolismo de la tiamina y la ruta de la represión catabólica por glucosa, como par-te de un proyecto europeo de investigación.

Gemma Beltran es autora o co-autora de un total de 15 publicaciones internacionales y 9 publicaciones na-cionales, ha participado en un total de 12 proyectos investigación o contratos de transferencia, asistido a 22 congresos científicos, dirigido tesis de master y está actualmente dirigiendo una tesis doctoral.

Actualmente es profesora de Bioquímica y Microbio-logiaEnológicaenlaFacultaddeEnología,ydesdesureincorporaciónalgrupodeBiotecnologíaEnológicade la URV en diciembre de 2007 ha estado colabora-do en proyectos de investigación y transferencia con el sector vitivinícola, centrándose nuevamente en el estudio de los requerimientos nitrogenados de las le-vaduras vínicas de primera y segunda fermentación.

Pone

ncia

s

5

Capítulo

Resumen:

La cantidad y calidad del componente nitrogenado de los mostos no determina únicamente un buen crecimiento de la levadura y una buena capacidad fermentativa, sino que influye directamente sobre la síntesis de un buen número de compuestos volátiles o aromas. En un trabajo de nuestro grupo (Beltran et al., 2005) comprobamos que las adiciones de nitróge-no asimilable en forma de aminoácidos, y después de la fase exponencial de crecimiento, aumentaban los niveles de alcoholes superiores y de algunos ésteres. En un estudio similar, Vilanova y cols. (2007) observa-ron también incremento en la síntesis de alcoholes superiores y en ésteres de acetato cuando los mostos eran suplementados con concentraciones de amonio no superiores a los 300 mg/l. Sin embargo, la concen-tración y fuente nitrogenada no solo tiene influencia en la síntesis de compuestos con impacto positivo en las calidades organolépticas de los vinos, sino que también varios trabajos han señalado una relación directa entre el nitrógeno asimilable y la síntesis de sulfhídrico. Otros factores nutricionales y ambientales relacionados con la síntesis de este compuesto han sido: la concentración de sulfatos y sulfitos (en forma de SO2) y la deficiencia en vitaminas (en concreto el ácido pantoténico y la tiamina).

1. introducción:

La transformación de la uva en vino es un proceso biotecnológico donde los microorganismos presen-tes, fundamentalmente las levaduras, utilizan los nu-trientes del mosto para su crecimiento, produciendo toda una gama de metabolitos que convierten un líquido empalagoso en una solución hidroalcohólica de sabor y aroma más agradable. La principal reacción bioquímica durante la fermentación alcohólica es la conversión de los azúcares en etanol. Sin embargo, no es la única. Un pequeño porcentaje de los azúcares van destinados a la síntesis de metabolitos secunda-rios (glicerol, succínico, láctico, acético, alcoholes su-periores, ésteres, etc), de menor concentración que el etanol pero que son los determinantes de la calidad del vino. También hay una pequeña parte de los azú-cares del mosto que va destinada a la síntesis de com-ponentes celulares, es decir, a la síntesis de biomasa. En esta síntesis de biomasa no solo intervienen los azúcares sino que es imprescindible el componente nitrogenado.

Aunque el componente nitrogenado es cuantitati-vamente el segundo nutriente más abundante en el mosto, presenta una gran desproporción con el componente carbonatado (azúcares). Mientras que la suma de glucosa y fructosa se encuentra del orden de 200 a 300 g/litro, concentraciones de mil veces menores (200-300 mg/litro) suelen ser valores muy habituales para el nitrógeno asimilable. Por tanto, son

muy frecuentes las situaciones industriales en las que el nitrógeno se convierte en un factor limitante para el desarrollo de las levaduras y para la finalización de la fermentación alcohólica. Son varios los autores que han tratado de establecer una concentración mínima donde se pone en peligro la fermentación alcohólica. Estos valores no coinciden entre los distintos trabajos, fluctuando de los 120-140 g Nitrógeno asimilable/l (Bely et al, 1990) hasta los 200 o 267 (Mendes-Ferreira et al, 2004), es decir más del doble. Dichas diferencias pueden ser debidas a varios factores, pero entre los más importantes podemos destacar dos: la cepa de levadura, perfectamente conocido por los producto-res de levaduras que incluso las catalogan como con elevado o bajo requerimiento nitrogenado o nutritivo y la forma química en que el nitrógeno está disponi-ble en el mosto. Evidentemente otros factores como la forma de vinificación, variedad de uva, etc. también son relevantes, pero su efecto se puede considerar como incluido en la forma química y cantidad de ni-trógeno en el medio.

El nitrógeno en el mosto puede estar presente en dos formas claramente diferenciadas: la inorgánica, bási-camente como amonio, y la orgánica, formada por aminoácidos, péptidos y proteínas. No todas estas for-mas son igualmente disponibles, ya que, por ejemplo, los péptidos y las proteínas no se suelen considerar como auténticas fuentes de nitrógeno, y los aminoá-cidos son muy variables como fuentes nitrogenadas, ya que mientras algunos son consumidos ávidamente (glutamina, por ejemplo), otros no lo son en absoluto en condiciones anaerobias como la prolina. Curiosa-mente la prolina, junto con la arginina, son los dos aminoácidos mayoritarios en mostos. La levadura necesita la presencia de oxígeno para llevar a cabo la utilización de la prolina, además este proceso de metabolización de la prolina se lleva a cabo principal-mente en la mitocondria, que se encuentra muy poco funcional en condiciones fermentativas. Sin embargo, no se ha estudiado si en condiciones de fermentacio-nes más aireadas, tales como durante la maceración en tintos, puede haber un consumo mayor de este aminoácido. El nitrógeno en forma de amonio suele ser altamente disponible para las levaduras, por lo que es una forma química que se suele utilizar de forma abundante en la industria enológica. La presencia de nitrógeno en cualquiera de estas formas químicas es fuertemente variable, dependiendo de diversos facto-res, entre ellos la variedad, grado de maduración de la uva, características edafo-climáticas en las que se desarrolla ésta y diversos aspectos tecnológicos (tipo de vinificación, prensado, etc).

En resumen, debemos considerar como nitrógeno asimilable (NA) por las levaduras en las condiciones de vinificación al amonio como fuente inorgánica (representa hasta el 40% del NA), y todos los ami-noácidos excepto la prolina. Sin embargo, la levadura vínica Saccharomyces cerevisiae no consume este ni-

6

Seminario técnico


trógeno asimilable de manera aleatoria, sino que tie-ne un orden de preferencia por los distintas fuentes de nitrógeno. S. cerevisiae ha desarrollado diferentes mecanismos moleculares que le permiten utilizar pre-ferentemente aquellas fuentes que le permiten crecer mejor. Este mecanismo de selección de la fuente de nitrógeno se conoce como “Represión Catabólica por Nitrógeno (NCR). El NCR se caracteriza porque la célu-la es capaz de detectar la presencia de las fuentes de nitrógeno más ricas. Esto desencadena una cadena de señales, que culmina con la activación de los genes implicados en el transporte y metabolismo de estas fuentes ricas y en la represión de aquellos genes im-plicados en el transporte y utilización de fuentes más pobres. Una vez consumida las fuentes de nitrógeno más ricas (amonio, glutamina y asparagina), la levadu-ra activa la maquinaria metabólica para la utilización de las más pobres (arginina, glutamato, alanina, etc.) (Figura 1).

Sin embargo, la importancia del nitrógeno no reside exclusivamente en ser necesario para la formación de biomasa. El contenido en nitrógeno también tiene una influencia clara sobre la velocidad fermentativa (Taillandier et al., 2007). La mayor parte de la fermen-tación alcohólica se produce en una fase de no proli-feración celular o estacionaria. En este punto el nitró-geno del medio es utilizado para el recambio proteico de los diferentes enzimas celulares. Por último, este contenido en nitrógeno tiene una influencia manifies-ta en los diferentes metabolitos producidos durante la fermentación, muchos de ellos con un impacto muy claro en el aroma del vino. A continuación trataremos en mayor profundidad los diferentes aspectos de la fisiología y metabolismo celular que se ven afectados tanto por la cantidad como por la calidad del nitró-

geno del mosto. Especial hincapié dedicaremos a la síntesis de aromas de reducción o producción de SH2 y otros compuestos derivados del metabolismo del azufre.

2. efecto de la concentración y tipo de nitrógeno sobre el crecimiento de las levaduras y su cinética fermentativa.

Varela y cols. (2004) propusieron que la velocidad de fermentación depende por un lado del estado meta-bólico de las células y por otro del número de células alcanzados durante la fermentación alcohólica. Dicho de otro modo, de la viabilidad (número de células fermentando) y la vitalidad de cada una de estas cé-lulas. Ambos componentes tienen una dependencia importante del nitrógeno disponible en el mosto. En este punto nos vamos a centrar en como afecta el ni-trógeno a la división celular o producción de biomasa y en el siguiente apartado abordaremos como afecta a la vitalidad o actividad celular.

En un trabajo reciente de nuestro grupo hemos com-probado como el nitrógeno es el substrato limitante del crecimiento celular hasta alcanzar valores cerca-nos a los 200 mg/l, aunque esto depende de la fuente de nitrógeno utilizada. Para ello hacíamos crecer las levaduras en un mosto sintético (similar al natural) donde iba cambiando únicamente la concentración de N y el tipo de fuente de N. Como puede verse en la figura 2, el número de células o biomasa (medido por la densidad óptica (O.D.) a 595 nm) iba aumentando conforme aumentaba la concentración de nitrógeno, en este caso en forma de arginina como única fuente de nitrógeno. Esto fue así hasta niveles de 180 mg de

Figura 1. Representación gráfica del mecanismo de “Represión Catabólica por nitrógeno (nCR)” según Cooper (2002)

Pone

ncia

s

7


N/l (en la gráfica solo se representa hasta 140 mg de N/l), por encima de esta cantidad ya no determina-mos diferencias en la biomasa obtenida.

Como se comenta anteriormente, no solo tiene impor-tancia la cantidad sino la calidad o tipo de nitrógeno. En un experimento similar determinamos la biomasa producida para la misma concentración de diferentes fuentes de nitrógeno. Como puede verse en la figura 3, la glutamina permite un mayor crecimiento celular que la arginina, y resulta sorprendente que la menor cantidad de biomasa producida se obtiene con la uti-lización de amonio, teóricamente una de las fuentes de nitrógeno más interesante para la levadura.

Varela y cols (2004) determinaron el efecto que tenía la cantidad de células en un mosto deficiente en N

(50 mg/l) sobre la velocidad y tiempo de fermenta-ción. Para ello añadían dos y 5 veces más de la dosis recomendable de levadura seca activa a los mostos. El resultado fue que en estas fermentaciones, con mayor concentración de células, se alcanzaban velocidades de fermentación similares a las obtenidas en un mosto rico en nitrógeno (300 mg/l). De esta manera mostra-ban una relación directa entre mayor concentración de biomasa y mayor velocidad fermentativa en mostos pobres en nitrógeno. Desde un punto de vista aplicado para la industria enológica, esto sugiere dos posibles soluciones frente a un mosto pobre en nitrógeno. La primera y más habitual solución consiste en la suple-mentación de los mostos con nitrógeno, fundamen-talmente en forma de sales de amonio. Como posible alternativa, sería la adición de una mayor cantidad de levadura seca activa o la adición de biomasa de otros

Figura 2. evolución de la OD de la cepa PDM en mosto sintético con arginina como única fuente de nitrógeno y con concentraciones crecientes entre 20 y 140 mg n/l.

— Amonio

— Arginina

— Glutamina

Figura 3. Comparativa de crecimiento en las tres fuentes de nitrógeno para una cantidad idéntica de 140 mg n/l.

8

Seminario técnico


tanques de fermentación. Aunque un aumento de la biomasa añadida podría tener efectos sobre el aroma y sabor del vino (excesivo sabor a levadura).

Mendes-Ferreira y col. (2004) también estudiaron el efecto de diferentes concentraciones de amonio sobre el crecimiento y la velocidad fermentativa. En este estudio, y para la cepa PYCC 4072, estos autores determinaron la producción máxima de biomasa (7,8 g/l) para una concentración de 402,5 mg de N/l. En concentraciones limitantes de N (66 mg de N/l) la cantidad de biomasa producida era 3,5 veces menor (2,2 g/l). Las concentraciones crecientes en N no solo afectaban a la producción de biomasa, sino a la velo-cidad de fermentación. Mientras la fermentación con una cantidad suficiente de N acabo la fermentación en 5 días, la fermentación limitante en N (66 mg de N/l) requirió 28 días para su finalización.

En nuestro grupo, para comprobar el efecto que tenía la adición de nitrógeno durante la fermentación alco-hólica, llevamos a cabo un trabajo donde adicionába-mos una mezcla de amonio y aminoácidos a mostos deficientes en N (60 mg/l) en diferentes fases de la fermentación (Beltran et al., 2005). En concreto, estas adiciones se hicieron en fermentaciones que estaban a densidades de 1080 (inicio de una fermentación), 1060 y 1040 (mitad de fermentación) y 1020 y 1000 (final de fermentación). Cuando la adición se realizaba al principio y mitad de fermentación (hasta 1040 de densidad), ésta tenía un efecto claro sobre el aumento de la biomasa (Figura 4). Si se realizaba en las fases finales (1020 y 1000 de densidad) ya no se registraba un aumento de la biomasa, pero si que se producía un aumento de la velocidad de fermentación (Figura 5). De hecho, la fermentación suplementada a una den-sidad de 1020 finalizaba la fermentación 5 días antes que la fermentación no suplementada con N. Estos resultados mostraban que el mejor momento para la adición de N era durante el crecimiento exponencial de la levadura (primeros días de fermentación). En esta fase tenía un efecto sobre el crecimiento celular y sobre la velocidad de fermentación.

En este trabajo también determinamos la cantidad de nitrógeno consumido en las diferentes fermenta-ciones. Como es de esperar, esta cantidad era mayor cuanto más temprano en el proceso se adicionaba el N (Figura 6). En esta misma figura, podemos ver la pre-ferencia de la levadura por el N inorgánico (amonio) o el orgánico (aminoácidos) en las diferentes fases. Resultó muy curioso comprobar que el amonio pare-ce ser la fuente de N preferida para la producción de biomasa (mayor consumo durante las primeras fases) mientras que apenas era consumida en las últimas fases de fermentación. Estas diferencias en la propor-ción de consumo de amonio o aminoácidos también produjeron diferencias en los perfiles organolépticos de los distintos vinos, como se explica en los siguien-tes apartados.

Figura 4. efecto de la adición de una mezcla de amonio y aminoácidos (240 mg de n/l) sobre la producción de biomasa medida como densidad

óptica (O.D. a 600 nm). la densidad a que se realizaba la adición viene reflejada en el pie de la

figura.

Figura 5. efecto de la adición de una mezcla de amonio y aminoácidos (240 mg de n/l) sobre la velocidad fermentativa, medida como reducción de la densidad del mosto. la densidad a que se

realizaba la adición viene reflejada en el pie de la figura.

Figura 6. Consumo de n total, amonio y aminoácidos (expresados como mg de n/l) en las

distintas fermentaciones.

3. efecto de la concentración y tipo de nitrógeno sobre la cinética fermentativa

Resulta evidente de nuestro anterior trabajo (Beltran et al., 2005) que el enriquecimiento en N del medio de fermentación tenía un efecto sobre la cinética fermentativa, independiente del crecimiento celular. Algunos autores (Taillandier et al., 2007) confirman que este efecto estimulador del consumo de azúca-res es incluso más importante que el efecto sobre el crecimiento. Este hecho resulta muy interesante des-de el punto de vista industrial si tenemos en cuenta

Pone

ncia

s

9


que la mayor parte de la fermentación alcohólica se produce en la fase estacionaria o de no proliferación celular. A pesar de que durante este periodo no hay multiplicación celular, las levaduras necesitan nitróge-no para mantener su metabolismo activo. El medio de fermentación es un ambiente cambiante y hostil que requiere una readaptación continua para las nuevas condiciones. Esta readaptación al medio supone un recambio proteico continuo en la maquinaria enzi-mática celular. Para este recambio de proteínas celu-lares, es necesaria la disponibilidad de nitrógeno en el medio de fermentación. Taillandier y col. (2007) es-tablecieron la cantidad de nitrógeno consumido por la levadura por gramo de azúcar consumido (mg N/g de glucosa o fructosa). Como siempre hay que contar con las diferentes necesidades de las distintas cepas, esta cantidad tenía un rango de 0,61 a 0,91 mg de N por gramo de azúcar. Es decir, una relación mg N/g azúcar prácticamente asegura cubiertas las necesida-des nitrogenadas y es una relación muy sencilla para el enólogo poder calcular las diferentes necesidades de sus mostos. Una relación similar establecieron Bisson y Butzke (2000), pero en este caso, entre necesidad de N asimilable frente a grado alcohólico probable (GAP) (figura 7).

Figura 7. Relación entre grado alcohólico probable (GaP) y cantidad necesaria de n asimilable (mg de n/l) para alcanzar dicha cantidad (Bisson y Butzke,

2000).

Sin embargo, el aumento de la cinética fermentativa no debe ser solo entendido por la disponibilidad de nitrógeno para facilitar el recambio proteico celular, sino que se ha demostrado que algunas fuentes de nitrógeno, en concreto el amonio, pueden actuar como activadores de la actividad de enzimas gluco-líticos claves. En concreto, se ha visto un incremento importante del transporte de azúcares por activación de las permeasas implicadas (genes HXT) (Bely et al., 1990). Taillandier y cols (2007) también informaron de una mayor actividad fructofílica (mayor consu-mo de la fructosa frente a la glucosa) de la levadura en presencia de mayor concentración de nitrógeno, probablemente por un cambio en la afinidad de los transportadores de hexosas. Igualmente, Berthels y

cols (2004) observaron una activación del enzima fos-fofructoquinasa, enzima clave de la glucolisis, con la adición de amonio.

4. Relación entre el contenido en nitrógeno y la síntesis de compuestos aromáticos

Además del efecto sobre el crecimiento, la disponibili-dad de nitrógeno también tiene un efecto importante sobre el metabolismo de las levaduras, afectando la formación de compuestos volátiles y no volátiles, los cuales son de gran importancia para las calidades or-ganolépticas del vino final (revisado por Alberts y col. 1998, Bell y Henkschke, 2005). La concentración de compuestos no volátiles como son el glicerol, el áci-do málico, ácido succínico o ácido alfa-cetoglutárico, puede variar dependiendo de la cantidad y la fuen-te nitrogenada presente en los mostos. Alberts y col. (1996) observaron, por ejemplo, que la concentración de glicerol es mayor cuando la ratio nitrógeno amo-niacal respecto al nitrógeno orgánico representado por los aminoácidos. En un trabajo de nuestro grupo (Beltran y col. 2005) observamos que la concentración de glicerol disminuye en fermentaciones con limita-ción de nitrógeno. Esto demuestra que la producción de glicerol es directamente proporcional a la produc-ción de biomasa.

Muchos de los compuestos volátiles, que son los que contribuirán al aroma final del vino, también están afec-tados por el tipo y/o concentración de nitrógeno dis-ponible para la levadura. Los compuestos mayormente afectados son el ácido acético, los alcoholes superiores, los ácidos grasos de cadena media y corta y sus ésteres etílicos, y los esteres de acetato. En la Figura 8 vemos relación entre la acumulación de algunos compues-tos volátiles y la concentración inicial de nitrógeno en vinos producidos a partir de mosto sintético con dos cepas Saccharomyces cerevisiae (resultados obtenidos por Carrau y col. 2007). De este trabajo se desprende que hay una relación inversa entre crecimiento (o dis-ponibilidad de nitrógeno) y producción de alcoholes superiores. Mientras que la mayor presencia de nitróge-no parece estimular una mayor producción de ésteres. Sin embargo, los resultados de este trabajo demues-tran que la concentración óptima de nitrógeno para la síntesis de ésteres depende de la cepa en cuestión. La cepa KU1 producía su máxima concentración de ésteres para una concentración de nitrógeno mucho menor que la cepa M522. Esta última tenía una mayor producción de estos compuestos.

La carencia en nitrógeno en los mostos es general-mente subsanada mediante adiciones de sales de amonio. En la Tabla 1 y Figura 9 observamos cómo afecta también el momento de la suplementación de nitrógeno a la producción de algunos de estos com-puestos.

10

Seminario técnico


El contenido en ácido acético varía según la concentra-ción de nitrógeno en el medio, habiendo una relación inversa entre la cantidad de ácido acético producido y la disponibilidad de nitrógeno a concentraciones bajas o moderadas de nitrógeno, pero una relación directa a concentraciones altas (Bely y col. 2003, Hernandez-Orte y col. 2006). De hecho, trabajos de Beltran y col. (2005) y de Vilanova y col. (2007) muestran que a mayor disponibilidad y consumo de nitrógeno por parte de la levadura, mayor producción de ácido acético (Figura 9). Esta mayor producción de acético a mayores con-centraciones de nitrógeno puede estar relacionada con una mayor tasa de crecimiento. El acético es pro-ducido por las levaduras como substrato para la síntesis de ácidos grasos, un mayor crecimiento podría justifi-car una mayor síntesis de acético. Otra posibilidad es que siempre hay una relación directa entre síntesis de glicerol y de acético. Por tanto, a concentraciones altas de nitrógeno se produce más glicerol y, por tanto, más acético. Resultado similar se observó con la producción de acetaldehído.

Los alcoholes superiores pueden aportar aromas pe-sados y desagradables a los vinos si se encuentran en

concentraciones muy altas (excluyendo el 2-fenileta-nol, que tiene aroma floral). Existe una relación inversa entre el contenido en alcoholes superiores y la con-centración inicial de nitrógeno, excepto por concen-traciones muy bajas de nitrógeno (Beltran y col. 2005, Vilanova y col. 2007, Carrau y col. 2008). Los alcoholes superiores se pueden formar a partir de aminoácidos (via de Ehrlich) o a partir del catabolismo de los azúca-res (via anabólica) (Figura 10). Esta última es la principal vía de producción de alcoholes superiores durante la fermentación alcohólica. Cuando hay poco nitrógeno disponible en el medio, hay un aumento en la síntesis de alpha-cetoácidos a partir de azúcares. Estos alfa-cetoácidos son los precursores en la síntesis de ami-noácidos, pero la escasez de nitrógeno alfa-amínico necesario en la reacción de transaminación, hace que los alfa-cetoácidos formados se acaben excretando en el medio en forma de alcoholes superiores, sin llegar a formar los aminoácidos necesarios. Sin embargo, en un medio con alto contenido en nitrógeno, el nitróge-no disponible permite la biosíntesis de aminoácidos, lo que reduce el exceso de alfa-cetoácidos y por tanto la producción de alcoholes superiores (Oshita y col., 1995).

Figura 8. Relación entre la acumulación de algunos compuestos volátiles y la concentración inicial de nitrógeno en vinos producidos a partir

de mosto sintético con dos cepas Saccharomyces cerevisiae (cepa M522 () y cepa KU1 ()).

(Carrau y col., 2008)

Pone

ncia

s

11


tabla 1. Relación entre el momento de la adición de nitrógeno y la producción de metabolitos secundarios por la levadura. las fermentaciones se realizaron con mosto sintético limitante en nitrógeno (60 mg/l

Yan), al que se añadió 240 mg/l de nitrógeno (mezcla amonio y aminoácidos) en distintos momentos de fermentación (densidad 1080 g/l o inicio, 1060, 1040, 1020, 1000 g/l y no suplementado). (Beltran y col. 2005)

COOH

NH2C

R

H

COOH

OC

R

H

OC

R

H

H

OHC

R

H

�‐

cetoácido

AlcoholsuperiorAminoácido Aldehido

Desaminación Descarboxilación Reducción

NH3 CO2

NADHNAD+

ViadeEhrlich:viacatabólicadeaas

Glucosa

Piruvato

Víaanabólicaodesíntesis

Figura 9. Relación entre la concentración de metabolitos secundarios (normalizados con el valor de mayor producción en cada caso) y el momento de la suplementación de nitrógeno. las fermentaciones se realizaron con mosto

sintético limitante en nitrógeno (60 mg/l Yan), al que se añadió 240 mg/l de nitrógeno (mezcla amonio y aminoácidos) en distintos momentos

de fermentación (densidad 1080 g/l o inicio, 1060, 1040, 1020, 1000 g/l y no suplementado).

Figura 10. Ruta de síntesis de alcoholes superiores a partir de aminoácidos (via de ehrlich) o a partir

de los azúcares (via anabólica)

12

Seminario técnico


Este efecto ha sido observado experimentalmente por distintos trabajos. Carrau y col. (2008) muestran claramente que la cantidad de alcoholes superiores disminuye con el aumento de nitrógeno disponible, aunque se observa el efecto inverso en la producción de 1-propanol (Figura 8d, 8e). Estos hechos también fueron observados en estudios realizados por nues-tro grupo de investigación (Tabla 1, Figura 9). En ellos vimos que la síntesis de alcoholes superiores dismi-nuye cuando un mosto limitante en nitrógeno se su-plementa durante la fase exponencial de crecimiento de las levaduras, disminuyendo así su periodo de limi-tación, y lo que lleva también a un mayor consumo total de nitrógeno que si se suplementa en fases más tardías de la fermentación. Por otro lado, si el nitróge-no es adicionado en fase estacionaria, después de un largo periodo de limitación, el contenido en alcoholes superiores aumenta considerablemente.

Los esteres de etilo y de acetato muestran una rela-ción más compleja con la disponibilidad de nitróge-no, debido a sus distintos orígenes de síntesis, pero, en la mayoría de los estudios, el acetato de etilo y los esteres de acetato están relacionados positivamente con la concentración de nitrógeno del medio.

4.1 Relación entre el contenido en nitrógeno y la síntesis de compuestos azufrados

Las levaduras vínicas pueden formar H2S a partir de compuestos de azufre inorgánicos (sulfato o sulfito), o compuestos orgánicos azufrados (cisteína o glutatión). Normalmente el mosto es deficiente en compuestos orgánicos azufrados, y esto puede llevar a la levadura a sintetizar algunos de estos compuestos a partir de fuentes inorgánicas, normalmente abundantes en el mosto. En Saccharomyces cerevisiae, la producción de H2S es el producto de la ruta de la secuencia de reducción del sulfato (SRS), y es un intermediario en la biosíntesis de los aminoácidos azufrados (metionina, y cisteína). (Figura 11).

Varios factores ambientales y nutricionales se han aso-ciado con la producción de H2S en condiciones de vi-nificación: la cepa de levadura utilizada, la cantidad de azufre presente en los mostos (ya sea en forma de sul-fito o de sulfato), la carencia de vitaminas, y la carencia o disponibilidad de nitrógeno. Varios estudios se han centrado en analizar este último punto, el impacto del nitrógeno en la formación de aromas de reducción o azufrados.

Para la biosíntesis de los aminoácidos azufrados (cis-teína y metionina) se requiere por un lado esqueletos de carbono que contengan nitrógeno (O-AH: O-acetilhomoserina, O-AS: O-acetilserina), los cuales de-rivan de un pool intracelular de nitrógeno, y por otro lado sulfito, que deriva de la ruta de reducción del

sulfato. En carencia de nitrógeno, disminuye el pool de nitrógeno intracelular y por tanto la síntesis de los precursores nitrogenados O-AS y O-AH, con lo que el sulfito producido no podrá utilizarse para la síntesis de aminoácidos y se excretará en forma de ácido sulfhí-drico (SH2). Así pues, el ratio de formación del H2S pa-rece estar regulado por los requerimientos celulares de aminoácidos azufrados, y por el mantenimiento de los pools de nitrógeno intracelular.

Jiranek y col. (1995) observaron que en fermentacio-nes vínicas existe una relación directa entre la limita-ción de nitrógeno y la síntesis de sulfhídrico. Algunos de sus resultados se muestran el la Figura 12 y Tabla 2. En la Figura 12 observamos que la producción de sulfhídrico por parte de la levadura aumenta en el momento en que el nitrógeno del medio se consume (en presencia de sulfito). Este efecto es mucho más pronunciado en fase exponencial de crecimiento, cuando la levadura tiene más requerimientos nitro-genados, que en fase estacionaria, donde disminuyen las necesidades nitrogenadas, y también la produc-ción de sulfhídrico. Estos autores relacionaron tam-bién este aumento en la producción con la actividad sulfito reductasa, la cual es mayor en fase exponencial de crecimiento.

Por otro lado, si un medio limitante en nitrógeno se suplementa con amonio o con la mayoría de aminoá-cidos, la producción de sulfhídrico disminuye. Pero este no es el caso de los aminoácidos azufrados (prin-cipalmente Cisteína, de manera individual o en com-binación con Metionina), la adición de los cuales da lugar a un aumento incluso mayor en la producción de H2S por parte de las levaduras (Tabla 2). Esto es de-bido a la liberación del sulfhídrico como subproducto

Figura 11. Ruta de síntesis de H2S a través de la secuencia de reducción del sulfato (SRS) y la ruta

de biosíntesis de aminoácidos azufrados (metionina y cisteína) en S. cerevisiae. adenosyl 5’-fosfosulfato

(aPS), 3’-fosfoadenosil 5’-fosfosulfato (PaPS), O-acetilserina (O-aS), O-acetilhomoserina (O-aH).

(Swiegers y Pretorius, 2007)

Pone

ncia

s

13


de la degradación / transaminación de estos aminoá-cidos para ser utilizados como fuente de nitrógeno.

En un trabajo reciente, Mendes-Ferreira y col. (2009) analizaron en varias cepas la relación entre la concen-tración de nitrógeno en el medio y la producción de varios compuestos aromáticos, entre ellos el ácido sulfhídrico. Los resultados obtenidos variaban entre las distintas cepas, la Figura 13 muestra los resultados de la cepa UCD522, considerada alta productora de sulfhídrico. La síntesis de H2S se produce en el mo-mento en que se consume el nitrógeno del medio, pero curiosamente el medio con una cantidad ópti-ma de nitrógeno (267 mg/l), el cual se consume a las 48 horas de fermentación, presenta valores mayores que el medio muy limitante en nitrógeno (66 mg/l). El exceso de nitrógeno disminuye la producción de

sulfhídrico, pero este exceso puede provocar por otro lado la inestabilidad del vino y la producción de otros compuestos indeseados.

Pero el ácido sulfhídrico no es el único compuesto azufrado que podemos encontrar en los vinos, a partir de este compuesto se pueden formar mercaptanos o tioles, algunos de los cuales aportan olores desagra-dables a los vinos, los temidos caracteres de reduc-ción. H2S es un compuesto altamente reactivo, y se

tabla 2. Producción de H2S por parte de la levadura aWRi77, 6 horas después de haber

suplementado un medio limitante en nitrógeno con aminoácidos o amonio de manera individual. la suplementación se realizó una hora antes de

que el nitrógeno inicial fuera consumido. los datos están normalizados al valor obtenido por el cultivo

suplementado con amonio (Jiranek y col. 1995)

Figura 13. Perfil de fermentación y de liberación de ácido sulfhídrico de la cepa UCD522 en medio

sintético y con distintas concentraciones de nitrógeno inicial: 66 mg/l (a), 267 mg/l (b) y 402

mg/l (c). (Mendes-Ferreira y col. 2009)

Figura 12. Relación entre la producción de H2S y el momento en que se produce la limitación

de nitrógeno durante la fermentación. las fermentaciones se realizaron con la cepa aWRi77

en mosto sintético con distintas concentraciones de nitrógeno inicial: 3.3 (), 16.6 () o 24.9 () mM. las flechas indican el momento en que se añadió

sulfito (132 μM) a los medios, 1 hora antes del consumo total de nitrógeno. (Jiranek y col. 1995)

14

Seminario técnico


puede combinar con otros componentes presentes en el vino para formar otros compuestos volátiles azufrados (Vermeulen y col. 2005). Por ejemplo, la re-acción del sulfhídrico con el etanol o el acetaldehído da lugar a etil-mercaptano (con olor a cebolla o gas natural), y por otro lado la formación de polisulfuros (dimetil disulfuro, dimetil trisulfuro y dimetil tetrasul-furo) proviene de la oxidación del metantiol, produc-to de la degradación de la metionina (Swiegers y Pre-torius, 2007). La levadura puede luego reducir estos compuestos disulfuro y formar mercaptanos, con las consecuencias organolépticas que esto supone.

Sin embargo, a pesar de la mala popularidad que tienen los compuestos aromáticos azufrados, no todos ellos aportan características negativas a los vinos, otros pue-den llegar a contribuir positivamente, como es el caso

de los tioles volátiles 4-mercapto-4-metilpentanona (4MMP), 3-mercaptohexanol (3-MH) y 3-mercaptohexi-lacetato (3MHA), los cuales forman parte de la identi-dad varietal del vino, especialmente en los vinos de la variedad Sauvingon Blanc. Estos compuestos azufrados varietales, se originan por la levadura en fermentación alcohólica a partir de precursores tiolicos inodoros que contienen moléculas de cisteína en su estructura (Swie-gers y col. 2007). Thibon y col. (2008) demostraron que en Saccharomyces cerevisiae, la represión catabólica por nitrógeno controla también la liberación de estos tioles volátiles a lo largo de la fermentación, reprimien-do probablemente las permeasas de aminoácidos que permiten la entrada de estos precursores a la célula, y reprimiendo la expresión del gen IRC7, que codifica para el principal enzima involucrado en la bioconver-sión de tioles (cistationa-β-liasa).

Bibliografía

alberts, e., C. larsson, G. liden, C. niklasson, l. Gustafsson (1996) Influence of the nitrogen source on Saccharomyces cerevisiae anaerobic growth and product formation. Appl Environ Microbiol 62: 3187-3195

alberts, e., G. lidén, C. larsson, l. Gustafsson (1998) Anaerobic redox balance and nitrogen meta-bolism in Saccharomyces cerevisiae. Recent Res. Dev. Microbiol. 2:253-279.

Bell, S.J., P.a. Henschke (2005) Implications of nitro-gen nutrition for grapes, fermentation and wine. Aust. J. Grape Wine Res. 11:242-295.

Beltran, G., B. esteve-Zarzoso, n. rozes, a. Mas, y J. M. Guillamon. influence of the timing of nitrogen additions during synthetic grape must fermen-tations on fermentation kinetics and nitrogen consumption. J agric. Food Chem, 53: 996-1002, 2005.

Bely,M., Sablayrolles,J.M., Barre,P. (1990). Automa-tic detection of assimilable nitrogen deficiencies du-ring alcoholic fermentation in oenological conditions. J.Ferment.Bioeng. 70, 246-252.

Bely, M., a. rinaldi, D. Dubourdieu (2003) Influence of assimilable nitrogen on volatile acidity production by Saccharomyces cerevisiae during high sugar fer-mentation. J. Biosci Bioeng. 96:507-512

Bisson,l.F., Butzke,C.e. (2000). Diagnosis and rectifi-cations of stuck and sluggish fermentations. Am.J.Enol.Vitic. 51, 168-177.

Carrau, F.M., K. Medina, l. Farina, e. Biodo, P.a. Henschke, e. Dellacassa (2008) Production of fer-mentation aroma compounds by Saccharomyces cerevisiae wine yeasts: effects of yeast assimilable ni-trogen on two model strains. FEMS Yeast Res. 8:1196-1207.

Cooper,t.G. (2002). Transmitting the signal of excess nitrogen in Saccharomyces cerevisiae from the Tor proteins to the GATA factors: connecting the dots. FEMS Microbiol.Rev. 26, 223-238.

Hernández-Orte, P., J.F. Cacho, V. Ferreira (2002) Relationship between varietal aminoacid profile of grapes and wine aromatic composition. Experimetns with model solutions and chemometric study. J. Agric. Food Chem. 50: 2891-2899.

Jiranek V, langridge P y Henschke Pa (1995a) Re-gulation of hydrogen sulfide liberation in wine-produ-cing Saccharomyces cerevisiae strains by assimilable nitrogen. Appl Environ Microbiol 61: 461–467.

Mendes-Ferreira,a., Mendes-Faia,a., leao,C. (2004). Growth and fermentation patterns of Saccha-romyces cerevisiae under different ammonium con-centrations and its implications in winemaking indus-try. J.Appl.Microbiol. 97, 540-545.

Pone

ncia

s

15


Mendes-Ferreira, a., C. Barbosa, V. Falcó, C. leao, a. Mendes-Faia (2009) The production of hydrogen sulphide and other aroma compounds by wine strains of Saccharomyces cerevisiae in synthetic media with different nitrogen concentrations. J. Ind. Microbiol. Biotechnol. DOI 10.10007/s10295-009-0527-x

Oshita, K., M. Kubota, M. uchida, M. Ono (1995) Clarification of the relationship between fusel alcohol formation and amino acid assimilation by brewing fu-sel alcohol formation and amino acid assimilation by brewing yeast using 13C-labeled amino acid. Procee-dings of the European Brewing Convention. Bruxelles, 387-394.

Swiegers J. H. y i. S. Pretorius (2007) Modulation of volatile sulfur compounds by wine yeast Appl Micro-biol Biotechnol 74:954–960

thaillandier, P., ramon-Portugal, F., Fuster, a. y Strehaiano P. (2007) Effect of ammonium concen-tration on alcoholic fermentation kinetics by wine yeasts for high sugar content. Food Microbiology 24: 95-100.

thibon, C., P. Marullo, O. Claisse, C. Cullin, D. Du-bourdieu, t. tominaga (2008) Nitrogen catabolic repression controls the release of volatile thiols by Saccharomyces cerevisiae wine fermentation. FEMS Yeast Res. 1-11.

Varela C, Pizarro F, agosin e (2004) Biomass content governs fermentation rate in nitrogen-deficient wine musts. Appl Env Microbiol 70:3392–3400.

Vermeulen, C., l. Gijs, S. Collin (2005) Sensorial con-tribution and formation pathways of thiols in foods: a review. Food Rev. Int. 21:69-137.

Vilanova, M., M. ugliano, C. Varela, t. Siebert, i.S. Pretorius, P.a. Henschke (2007) Assimilable nitro-gen utilisation and production of volatile and on-vo-latile compounds in chemically defined medium by Saccharomyces cerevisiae wine yeasts. Appl. Microbiol. Biotechnol. 77:145-157.

16

Seminario técnico


Pone

ncia

s

17

02. los nuevos retos en microbiología del vino. levaduras no productoras de SH2

isak S. Pretoriusthe australian Wine Research institute, PO Box 197, Glen Osmond, adelaide, Sa 5064, australia

Contenido19 Resumen

19 1. Introducción

20 2. Control de la dinámica de la fermentación

de la levadura para mejorar la calidad del vino

21 3. Optimización de la fermentación

22 4. Optimización de la calidad del vino: evitar la

producción de sabores y aromas indeseables

23 5. Optimización de la calidad del vino: mejora

del aroma deseable, el sabor y el color

24 6. Aumento de las opciones de los vinicultores

mediante el desarrollo de cepas de levaduras

vinícolas mejoradas y novedosas

25 7. Conclusiones y previsiones futuras

25 8. Agradecimientos

25 9. Lecturas complementarias

Seminario técnico


Professor i.S. (Sakkie) PretoriusManaging Director

TheAustralianWineResearch InstituteLtd,POBox197,GlenOsmond,Adelaide,SA5064,Australia

Tel.: +61-8-83036610; Fax: +61-8-83036601

E-mail:[email protected]

Sakkie Pretorius se licenció en la University of theOrangeFreeState(Sudáfrica)yobtuvosudoctoradoen genética molecular de levaduras , bajo la direc-cióndelProfesorJuliusMarmurenelAlbertEinsteinCollegeofMedicinedeNewYorken1986.Enlaac-tualidadesdirectorgerentedelAustralianWineRe-search Institute, localizadoenAdelaida.Esademásprofesor asociado de la Universidad de Adelaida

Sus investigaciones están centradas en la microbio-logía y biotecnología del vino. Ha supervisado a 31 estudiantes de Doctorado y 56 estudiantes de Mas-ter en Ciencias. Ha publicado más de 200 artículos de investigación y capítulos de libros, impartido más de 500 lecciones magistrales y conferencias y es au-tor de 6 patentes.

Defiende como principio que la investigación del vino debe perseguir en primer lugar el conocimien-to, pero también responder a las necesidades de productores y consumidores, tanto en la selección del tema de investigación como en el diseño expe-rimental. Cree que la investigación inspirada en la búsqueda de conocimiento de los principios fun-damentales y en las consideraciones de una aplica-ción futura es la más poderosa dinamo del progreso tecnológico y que con una mínima inyección de re-cursos obtiene una sustancial calidad mejorada del producto, beneficios en la salud del consumidor y escaso impacto ambiental.

Resumen

Un mundo sin levaduras, esos humildes hongos uni-celulares que nos ayudan a confeccionar alimentos y bebidas, también nos negaría la capacidad de hacer avanzar las fronteras de la ciencia y de la tecnología. La mayor parte de todo el abanico de funciones des-empeñadas por las levaduras es realizada por una sola especie, la Saccharomyces cerevisiae. De todas sus fun-ciones, esta levadura es bien conocida por su capa-cidad para impulsar la transformación del mosto en vino. Si bien la Saccharomyces cerevisiae es conocida como la levadura vinica, no se pueden considerar to-das sus cepas iguales, dadas sus diferencias en el de-sarrollo de la fermentación y atributos organolépticos. En la enología moderna, donde es esencial disponer de fermentaciones rápidas y fiables para producir vi-nos estables en el tiempo y con estilo predetermina-do y una calidad predecible, se prefiere la inoculación en el mosto de cepas seleccionadas de Saccharomy-ces cerevisiae. Actualmente seguimos profundizando en el conocimiento de las interacciones asociadas con el vino que se producen entre nutrientes, precurso-res de sabores derivados de la uva, condiciones de la fermentación y cepas específicas de levaduras. El pre-sente documento aborda cómo los enologos pueden gestionar correctamente la fermentación a través de la dinámica de las levaduras en los mostos con el fin de optimizar su rendimiento y evitar el desarrollo de sabores y aromas indeseables, y sacar partido de ce-pas especializadas de levaduras de nuevo desarrollo y de las estrategias de inoculación para mejorar la ge-neración de sabores.

1. introducción

Imagínese, si puede, un mundo sin levaduras. Ima-gínese que se encuentra entre las muchas personas que asumen la comida y la bebida que hay en sus mesas sin preguntarse cómo ha llegado hasta allí, tan sana y rica. Imagínese un mundo sin nada para su-bir la masa al cocer el pan, sin nada con lo que hacer cerveza, vino o bebidas de alta graduación. Imagíne-se también un mundo en el que nuestra capacidad para hacer avanzar las fronteras de la ciencia y de la tecnología en varios frentes de manera sana y relati-vamente barata estuviera muy limitada. Y por último imagínese un mundo con muy pocas alternativas con las que convertir los residuos agrícolas ricos en azúcar en bioetanol para el uso como fuentes de energía re-novables. Si puede imaginarse todo eso, estará vien-do un mundo en el que nuestro avance tecnológico y nuestro patrón de utilización de energía, nuestra gastronomía, jovialidad y buen estilo de vida se verían afectados considerablemente.

Lo que necesitamos y explotamos parar evitar tal mundo inimaginable es un humilde hongo unicelular que durante milenios nos ha ayudado a confeccionar

Pone

ncia

s

19

02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH2

alimentos y bebidas, y que en los últimos tiempos ha sido moldeado por selección artificial para realizar una más vasta, si cabe, variedad de funciones — primero como agente de fermentación vital en panificadoras, fábricas de cerveza, bodegas de vino y destilerías y, en los tiempos más recientes, como herramienta científica en los laboratorios de investigación y como minifábricas para la producción de productos biotec-nológicos de “bajo volumen y gran valor” tales como enzimas, productos químicos, proteínas terapéuticas y otros productos farmacéuticos importantes comer-cialmente. Lo que es aún más increíble es que la ma-yoría de esta gama de diversas funciones es realizada por una única especie de levadura, la Saccharomyces cerevisiae. No obstante, de todas estas funciones y productos, esta extraordinaria levadura es probable-mente mejor conocida por su capacidad para trans-formar la dulce, azucarada y poco sabrosa uva en el producto distintivo y rico en sabor que conocemos como vino.

Los términos levadura y fermentación provienen eti-mológicamente de palabras que se refieren al efecto de “hervir” o “burbujear” producido cuando el azúcar se convierte bioquímicamente en alcohol etílico y dióxido de carbono, pero la fermentación producida por las levaduras es mucho más que eso. De hecho, es la responsable de la mayoría de los cambios asocia-dos con la biotransformación del mosto en vino – el aroma, el sabor, la sensación en el paladar, el color y la complejidad química son producidos por la levadura conforme diversifica y amplía su mundo con los pro-ductos de su metabolismo.

Tradicionalmente el vino se elaboraba con las de leva-duras ambientales que realizaban una fermentación espontánea; la inoculación deliberada de cultivos de levaduras puras es una técnica relativamente reciente. En la fermentación espontánea, existe una sucesión de levaduras indígenas provcedentes del viñedo y de la bodega, pero las etapas finales están dominadas de manera invariable por cepas de Saccharomyces cere-visiae tolerantes al alcohol. Hace mucho tiempo esta importante especie conocida universalmente como la levadura del vino, evolucionó su capacidad para fa-bricar, acumular, tolerar y, bajo ciertas condiciones de crecimiento, incluso consumir alcohol, mientras que simultáneamente produce metabolitos que mejoran el sabor y el aroma, tan importantes en nuestra apre-ciación sensorial del vino. No obstante no todos los miembros de la “tribu” Saccharomyces cerevisiae pue-den considerarse “iguales”, dado que existen diferen-cias en su robustez, rendimiento de la fermentación y en los atributos sensoriales que introducen en el vino que las hacen únicas.

En la vinicultura moderna, donde es esencial dispo-ner de fermentaciones rápidas y fiables para producir homogéneamente vino según unas especificaciones definibles de sabor, unos estilos predeterminados y

una calidad predecible, se prefiere la inoculación de cepas seleccionadas de Saccharomyces cerevisiae en el mosto. Las funciones principales de estas cepas seleccionadas son establecer un dominio numérico y metabólico en la fase temprana de la fermentación del vino y catalizar la conversión completa y eficiente de los componentes de la uva a alcohol, dióxido de carbono y metabolitos que mejoran su sabor y aroma sin desarrollar sabores y aromas indeseables.

La elección de la cepa de levadura a inocular en el cal-do y la gestión eficaz de las interacciones entre la leva-dura, el mosto y las condiciones de fermentación son factores importantes que determinan la duración de la fermentación y la composición química y las pro-piedades organolépticas de un vino. En los apartados siguientes se aborda brevemente cómo los enólogos pueden controlar la dinámica de la levadura en los cal-dos para optimizar el desempeño de la fermentación y por tanto evitar el desarrollo de muchos sabores y aromas indeseables y cómo pueden aprovecharse de cepas especializadas de reciente desarrollado para gestionar correctamente la fermentación del vino.

2. Control de la dinámica de la fermentación de la levadura para mejorar la calidad del vino

A diferencia de las prácticas microbiológicas en otros sectores de la industria agroalimentaria, en enología los microorganismos asociados con las uvas, otras materias primas y la maquinaria de procesamiento pueden entrar en el proceso de fermentación e influir en su eficacia y en la calidad del producto. Las uvas albergan una gran variedad de levaduras y bacterias epifíticas y, dependiendo de la adición de sulfitos, la temperatura de la uva, el tiempo empleado en el transporte a la bodega, el estado higiénico de las ma-quinaria de procesamiento de la uvas y los procedi-mientos de premaceración, prensado y clarificación, así será la proporción de levaduras que sobreviven en el zumo o mosto. Estas levaduras pueden proliferar en el zumo o mosto junto con los microorganismos aso-ciados al equipo de procesamiento dependiendo de las condiciones fisicoquímicas y de nutrientes.

Las etapas tempranas de la fermentación son domina-das habitualmente por especies poco fermentativas como la Hanseniaspora uvarum (anamorfo de Kloec-kera apiculate), debido a su gran tamaño poblacional inicial. Con una prevalencia numéricamente inferior a estas levaduras existen especies de Candida, Crypto-coccus, Debaryomyces, Dekkera (anamorfo de Bretta-nomyces), Issatchenkia, Kluyveromyces, Metschnikowia, Pichia, Rhodotorula, Saccharomycodes, SchizoSaccha-romyces, Torulaspora y ZygoSaccharomyces. Algunas de las levaduras mejor adaptadas no pertenecientes al género Saccharomyces tienden a reemplazar a las especies débilmente fermentativas, pero finalmente

20

Seminario técnico


son también reemplazadas por las Saccharomyces, ya que éstas últimas están mejor adaptadas al elevado contenido etílico y las condiciones anaeróbicas del mosto o zumo en fermentación. Saccharomyces cere-visiae es habitualmente la levadura dominante en la mayoría de las regiones vinícolas del mundo, si bien la especie criotolerante Saccharomyces bayanus es la dominante más frecuente en las regiones más frías. Saccharomyces paradoxus se encuentra en varias re-giones frías de Europa del Este.

Los tratamientos de clarificación y la aplicación de sul-fitos habitualmente reducen el número de levaduras indígenas y, si inocula un cultivo vigoroso activador, éste dominará a la microflora indígena. Sin perjuicio de lo anterior, el uso subóptimo de sulfitos antes de la fermentación puede, por ejemplo, afectar a la eficacia de la fermentación y a la calidad del vino. Si las condi-ciones lo permiten, la Hanseniaspora uvarum indígena puede desarrollarse rápidamente y eliminar nutrientes importantes del mosto. Por ejemplo, la tiamina, la cual es esencial para que las Saccharomyces produzcan etanol eficazmente, puede consumirse rápidamen-te. La Hanseniaspora uvarum puede también generar sabores y aromas no deseables, especialmente ácido acético y acetato de etilo. Los lactobacilos también se pueden multiplicar rápidamente y producir ácido acético junto con otros compuestos antagonistas de las levaduras, de modo que ralentizan o paran la fer-mentación. Con el reciente descubrimiento de que la Dekkera bruxellensis puede estar presente en las uvas, al menos en la región de Burdeos, la entrada de esta levadura contaminante en la corriente del vino ahora es más obvia. Además, el uso de sulfitos apa-rentemente no afecta a su establecimiento durante la fermentación dado que posee una tolerancia relativa-mente alta a este agente antimicrobiano.

A pesar de que los caldos en fermentación espontá-neos (levaduras “naturales”, “salvajes” o “silvestres”) ha-bitualmente tardan más en fermentar que los inocula-dos (y habitualmente más de lo que la mayoría de los vinicultores están dispuestos a aceptar) y a pesar de que el resultado de un mosto en fermentación espon-tánea no siempre es predecible, no existe consenso entre los vinicultores del mundo sobre si es mejor usar cultivos iniciales o dejar la fermentación espontánea. En un extremo se encuentran aquellos que continúan utilizando levaduras indígenas exclusivamente, dado que creen que la contribución única de diversas espe-cies de levaduras confiere una complejidad al vino no vista en fermentaciones inoculadas o guiadas. Otros prefieren empezar con levaduras nativas y posterior-mente inocular un cultivo activador. Otros inician la fermentación con activadores pero a un nivel de ino-culación inferior al recomendado. En la producción vinícola a gran escala, donde es esencial disponer de fermentaciones rápidas y fiables para conseguir un sabor homogéneo y una calidad predecible, se pre-fiere utilizar cultivos seleccionados de levaduras puras

con una capacidad, un conteo de células viables y una vitalidad conocidos. Con el fin de obtener los bene-ficios de la fermentación espontánea y guiada, cada vez más vinicultores están co-inoculando dos o más cepas diferentes pero compatibles de Saccharomyces cerevisiae, o mezclas de cultivos compuestas de una cepa de Saccharomyces cerevisiae y otra especie de Saccharomyces o no perteneciente a este género. Se debe optimizar la proporción de las cepas o especies seleccionadas en los cultivos de siembra con el fin de obtener los mejores resultados previstos.

3. Optimización de la fermentación

Cuando se prepara el mosto a partir de uvas sanas y maduras, con una población baja de microorganismo indígenas y un buen equilibro de nutrientes, si a este mosto se inocula un cultivo de levaduras vigoroso, la fermentación empieza y finaliza rápidamente, de-jando una pequeña cantidad de azúcar residual. Bajo estas condiciones ideales, las fermentaciones subóp-timas son relativamente infrecuentes. No obstante, cuando se producen, es necesario recuperar recursos considerables y pueden conducir a la pérdida de la calidad del vino por un deterioro oxidativo, microbio-lógico o autolítico de las levaduras.

Se pueden producir fermentaciones subóptimas en cualquier tipo de vino o producto en fermentación, y éstas pueden ocurrir incluso cuando se utilizan las cepas más robustas fisiológicamente hablando. Si bien las levaduras son enormemente adaptativas al ambiente del mosto, las condiciones fisicoquímicas y nutritivas no siempre son favorables para una acti-vidad fisiológica vigorosa y, a menos que la levadura se pueda adaptar a condiciones cambiantes durante la fermentación, una reducción del estado fisiológico puede conducir a una fermentación incompleta.

Habitualmente se observan cuatro tipos de fermenta-ciones subóptimas: (i) inicio con retraso; (ii) fermenta-ción continuamente lenta; (iii) fermentación ralentiza-da; y (iv) fermentación incompleta o interrumpida. Las fermentaciones que comienzan después de un tiem-po, pero que a menudo finalizan por ellas mismas de manera normal, son habitualmente el resultado de la utilización de un cultivo activador con una calidad de-ficiente. Las fermentaciones que constantemente son lentas, que pueden llegar a su finalización, habitual-mente son el resultado de una cantidad reducida de nitrógeno asimilable. Las fermentaciones ralentizadas e interrumpidas, sin embargo, parecen ser causadas por varios factores relacionados con las interacciones entre la fisiología de las levaduras, el estado de los nutrientes del mosto, la presencia de inhibidores y las condiciones de fermentación.

Concentraciones elevadas de azúcar en el mosto, lo cual viene determinado principalmente por la ma-

Pone

ncia

s

21


durez de la uva en su vendimia, es probablemente la causa principal de fermentaciones ralentizadas e inte-rrumpidas, y esto se debe a su vez primordialmente a la relación entre la concentración inicial de azúcar y la producción final de etanol; cuanto más azúcar hay en la uva, más alcohol habrá en el vino. Este problema se magnifica por la tendencia a utilizar uvas muy madu-ras o demasiado maduras en las bodegas. Por tanto, cada vez es más importante elegir cepas de levaduras con alta tolerancia al etanol.

El riesgo de que aparezcan problemas de fermenta-ción aumenta cuando el mosto tiene un contenido subóptimo de nutrientes, especialmente de nitróge-no asimilable y vitaminas. Es importante saber que estas últimas se pueden perder durante la vendimia y el procesamiento del mosto. Un elevado índice de azúcar con respecto a otros nutrientes puede provo-car una reducción de la cantidad de biomasa y una bajada de la velocidad de fermentación, así como el inicio precoz de la inactivación del transporte de azú-car en las levaduras.

La clarificación del mosto es un factor importante en la fermentación de vinos blancos debido al profundo efecto que la disminución de los sólidos de las uvas tiene sobre la definición de la variedad de la uva, so-bre el sabor y aroma del vino y sobre la aparición de aromas fenólicos indeseables. No obstante, el exceso de clarificación elimina lípidos importantes necesa-rios para que las levaduras puedan tolerar el etanol; en la práctica se adquiere una solución de compromiso determinada por la experimentación para establecer el nivel de sólidos de la uva que favorecen una tasa satisfactoria de fermentación manteniendo la calidad del vino en un nivel aceptable. La incapacidad de fi-nalizar la fermentación de mostos demasiado clarifi-cados, con una elevada cantidad de azúcar y una fer-mentación anaeróbica, pueden evitarse parcialmente introduciendo un paso de aireación breve durante la fermentación. La aireación, unida a la adición de ni-trógeno asimilable después de que haya finalizado la fase de crecimiento de las levaduras, revigoriza con-siderablemente la fermentación. Este paso de airea-ción no tiene un impacto detectable sobre el sabor del vino e incluso es beneficioso ya que minimiza el riesgo del desarrollo de sabores y aromas indeseables que podrían originarse a partir de una fermentación incompleta.

No obstante, cuando la fermentación se frena debido a una cantidad elevada de azúcar, el procedimiento de rescate más exitoso depende de la adaptación se-cuencial de un cultivo fresco de levaduras a los inhi-bidores del vino en fermentación interrumpida. Este procedimiento, que comienza preparando un cultivo activador de una levadura altamente tolerante al eta-nol, implica multiplicar sucesivamente por dos el vo-lumen de cultivo, por adición al vino en fermentación interrumpida, a la vez que se mantienen la aireación y

el aporte de nutrientes. Después de dos a cuatro ciclos de adaptación al vino en fermentación interrumpida, el cultivo de rescate altamente adaptado puede fina-lizar la fermentación en presencia de concentraciones de etanol y de ácidos grasos volátiles normalmente inhibidoras. Los procedimientos que mantienen la le-vadura en suspensión hasta que vuelve a comenzar la producción de CO2 mejoran más la tasa y la probabili-dad de que se complete la fermentación.

4. Optimización de la calidad del vino: evitar la producción de sabores y aromas indeseables

Es importante gestionar los nutrientes de la fermenta-ción con el fin de mantener una tasa de fermentación vigorosa, alcanzar un punto final de bajo contenido de azúcar residual y disminuir la producción de sabores y aromas indeseables. Las uvas cultivadas en regiones con suelos de bajo contenido orgánico y pocas lluvias en la temporada de crecimiento pueden contener un nivel de nutrientes inferior al óptimo, especialmente de nitrógeno asimilable, el cual es necesario para el crecimiento de las levaduras y su función metabólica. Se conoce bien cómo afecta la nutrición del nitróge-no sobre la producción de compuestos volátiles de azufre. Durante la fermentación de mostos con pocos nutrientes, la cantidad de nitrógeno asimilable baja precozmente e induce la producción de sulfuro de hidrógeno (H

2S) debido a la ausencia de compuestos

que capten el sulfuro. En muchos casos se puede con-trolar la producción de H

2S mediante la adición de sa-

les nitrogenadas como el fosfato de diamonio. Otros estudios sugieren que es necesaria una concentración de 200 – 250 mg/L de nitrógeno asimilable para mi-nimizar el riesgo de producción de H

2S. No obstante,

no todas las cepas comerciales responden a la mejora del mosto por la adición de fosfato de diamonio, y el fallo en la respuesta habitualmente indica una defi-ciencia en el mosto de una o más vitaminas, de ácido pantoténico, de piridoxina o biotina, los cuales están implicados en el metabolismo del H

2S. La persisten-

cia de problemas por producción de H2S, aún con la

suplementación de nutrientes, requiere la selección de una levadura de baja producción de H

2S en tales

mostos. La ausencia de respuesta sobre el H2S tam-

bién puede venir originada por la presencia de azufre elemental residual que no se ha utilizado en la viña según las recomendaciones del fabricante o cuando la vendimia se ha realizado prematuramente debido a condiciones meteorológicas adversas.

El exceso de algunos nutrientes también puede pro-vocar la aparición de sabores y aromas indeseables. La utilización excesiva de ácido nicotínico, presente en algunos suplementos nutritivos, se asocia con la producción de ácido acético. La utilización excesiva de fosfato de diamonio también puede provocar la aparición de sabores indeseables. El fosfato de dia-

22

Seminario técnico


monio estimula la producción de ésteres, los cuales en cantidades moderadas pueden ser beneficiosos, pero cuando la concentración total de ión amonio se acerca al nitrógeno máximo que la levadura puede consumir (aprox. 400 – 500 mg/L de nitrógeno asimi-lable), la producción de acetato de etilo es excesiva provocando un sabor indeseable debido a este éster volátil. Como una posible alternativa, existen algunos datos sobre productos de levaduras inactivadas que al utilizarse cuando se rehidrata la levadura seca activa pueden reducir el riesgo de producción de H

2S. Dado

que el nitrógeno asimilable afecta tanto sobre la pro-ducción de sabores indeseables durante la fermenta-ción, es importante medir el nitrógeno asimilable en los zumos o mostos antes de la fermentación con el fin de optimizarlo. En los viñedos con historia de pro-blemas de fermentación, se deben llevar a cabo análi-sis de nitrógeno en varias temporadas.

A menos que existan condiciones higiénicas deficien-tes en la bodega, normalmente no se puede detectar la contaminación por “Brettanomyces” durante la fer-mentación. Sin embargo, cuando la Dekkera bruxellen-sis está presente, incluso en un número relativamente bajo, si el inicio o la terminación de la fermentación maloláctica tarda mucho, el riesgo de crecimiento de la D. bruxellensis y la producción de etil fenoles au-menta considerablemente. Las condiciones fisicoquí-micas y nutritivas existentes durante la fermentación maloláctica son favorables para el desarrollo de esta levadura contaminante, y toda condición que perju-dique el desarrollo de la Dekkera bruxellensis también retrasará el desarrollo de bacterias malolácticas. Por tanto, para controlar esta levadura contaminante es obligatorio mantener su tamaño poblacional en un mínimo inmediatamente después de la fermentación alcohólica y antes de la inducción de la fermentación maloláctica. Minimizar los nutrientes residuales, espe-cialmente fructosa y nitrógeno asimilable puede ser beneficioso para este fin, y la compatibilidad entre la levadura y las bacterias malolácticas utilizadas para las fermentaciones primaria y secundaria está resultando ser un factor importante para el éxito de las fermenta-ciones malolácticas.

5. Optimización de la calidad del vino: mejora del aroma deseable, el sabor y el color

De lo anterior se desprende claramente que existen muchas herramientas para minimizar el riesgo de de-sarrollar sabores y aromas indeseables durante la fer-mentación, pero debemos considerar qué estrategias podemos emplear para que las fermentaciones pro-porcionen características positivas al vino.

La rehidratación de la levadura con nutrientes de le-vaduras inactivas puede estimular la producción de aromas afrutados. De manera similar, niveles modera-

dos de nitrógeno asimilable, ca. 200 – 350 mg/L, me-jora el equilibrio de los ésteres florales con respecto a los alcoholes de fusel, dotando al vinos de sabores más frescos y limpios. El fosfato de diamonio estimu-la la producción de ésteres de acetato especialmen-te, pero también de etil estéres afrutados, e impide la producción de alcoholes superiores, los cuales tienden a afectar negativamente al aroma del vino. No obstante, se debe tener cuidado de no sobredi-mensionar la adición de nitrógeno a partir de fuen-tes como el fosfato de diamonio, ya que, como se ha indicado anteriormente, esto puede conducir a una producción excesiva de ésteres de acetato. Es más, investigaciones recientes indican que la adición de fosfato de diamonio puede reducir la respuesta de los precursores responsables de los aromas a frutas tropi-cales en Sauvignon Blanc y otras variedades similares; ya que se desfavorece la hidrólisis de conjugados de la cisteína, por lo que disminuye la producción de tioles polifuncionales de cadena larga.

Otra herramienta importante que puede ayudar a los vinicultores a producir vinos con perfiles sensoriales específicos y según las especificaciones del mercado es la elección de la cepa de levadura y la estrategia de inoculación. Por ejemplo, ahora sabemos que la le-vadura desempeña un papel esencial en la evolución de moléculas responsables del aroma provenientes de la propia levadura y de la uva. Las primeras son las grandes responsables del carácter del vino, e incluyen metabolitos volátiles de la levadura como ésteres, al-coholes superiores, ácidos, carbonilos y compuestos de azufre, mientras que las últimas contribuyen a los caracteres específicos de las variedades. Existen dos clases importantes de compuestos derivados de la uva que son precursores del sabor y el aroma: los con-jugados de la cisteína y los conjugados con grupo de enlace de azúcar (o grupo gluco-). Los conjugados de la cisteína, que están presentes en la variedad Sauvig-non Blanc y en variedades relacionadas, son hidroliza-dos durante la fermentación por la acción de enzimas carbono-azufre-lasas. Esta hidrólisis libera potentes tioles volátiles como 4-mercapto-4-metilpentan-2-ona (4MMP) y 3-mercaptohexanol (3MH), los cuales son responsables de aromas a maracuyá, boje, po-melo y grosella negra. Además, el 3MH es esterifica-do por una alcohol acetiltransferasa codificada por el gen ATF1 para producir el más potente acetato de 3-mercaptohexilo (3MHA). En unos recientes estudios de co-fermentación se inocularon dos cepas de leva-duras vinícolas en zumo de uva Sauvignon Blanc. Una cepa hidrolizó el conjugado y la otra esterificó el pro-ducto, por lo que las dos se complementaban entre sí y mejoraban los sabores y aromas de la Sauvignon Blanc.

Los glucoconjugados no volátiles de las uvas son es-pecialmente importantes para el desarrollo del aroma de los vinos a partir de variedades de uvas muy aro-máticas como la Muscat y la Riesling, y también de al-

Pone

ncia

s

23


gunas variedades no aromáticas como la Chardonnay, la Semillon y la Sauvignon Blanc. Entre los ejemplos de compuestos derivados de la fruta con sabor y aroma potenciales se encuentran los alcoholes monoterpe-nos florales linalool y geraniol, así como los norisopre-noides tales como la β-damascenona. En variedades no aromáticas, estos sabores y aromas se desarrollan durante la fermentación, y la acidez del vino, la cual permite una hidrólisis química de los precursores no volátiles de aromas lenta, se ha considerando durante mucho tiempo una ruta importante de la formación de estos compuestos. No obstante, trabajos recientes demuestran la existencia de al menos otras cuatros rutas (en las que están implicadas las levaduras). De estas, la hidrólisis de glucoconjugados por glucósidos extracelulares de las levaduras parece ser la más im-portante cuantitativamente durante la fermentación.

El color es otro atributo sensorial del vino muy impor-tante y, en el vino tino, éste está ampliamente deter-minado por los antocianinos y pigmentos derivados de la antocianina. Existen numerosos factores viticul-turales y viniculturales implicados en la formación y en la estabilización del color del vino tinto, no obstan-te el papel de la levadura solamente se ha estudiado recientemente. La elección de la cepa de levadura no sólo afecta a la profundidad del color, sino que también a su matiz; los tonos rojo-morados. Existe un estudio en curso para comprender el mecanismo bioquímico que afecta al desarrollo del color del vino. Los conocimientos extraídos de este estudió permiti-rán desarrollar estrategias genéticas para personalizar cepas de levadura con el fin de ofrecer a los consumi-dores vinos de un aspecto excepcional.

6. aumento de las opciones de los vinicultores mediante el desarrollo de cepas de levaduras vinícolas mejoradas y novedosasActualmente es indudable que las levaduras desem-peñan un papel esencial a la hora de dotar al vino de sus propiedades sensoriales. Durante siglos de vini-cultura se han aislado y utilizado, accidental o deli-beradamente, cepas de Saccharomyces cerevisiae por su capacidad para convertir eficazmente el mosto de uva en vino a pesar de su exposición a un esfuerzo osmótico, de nutrientes y etílico. Estas levaduras han desarrollado una serie de características específicas de cada cepa, como la producción de diversos sabores y aromas y diferentes perfiles de utilización de nutrien-tes, lo cual es reflejo de su historia y ahora puede em-plearse para adecuar cepas específicas a las condicio-nes y estilos concretos de cada vino. Además de esta diversidad de opciones disponibles en la actualidad, se han mejorado muchas cepas de levadura vinícola utilizando métodos genéticos clásicos (mutagénesis, hibridación, evolución adaptativa), y en los últimos tiempos mediante ADN recombinate (también cono-

cida como tecnología de modificación genética).

A este respecto, el desarrollo de cepas de levaduras de vino es una fuente importante de una nueva di-versidad genética para mejorar las opciones disponi-bles de los vinicultores. Por ejemplo, la producción de híbridos intra- e inter-específicos del género Saccha-romyces permite la generación de cepas novedosas de levaduras con las propiedades de fermentación robusta de la levadura vinícola comercial y las diversas propiedades sensoriales ofrecidas por otras especies. El sector está actualmente evaluando desde un punto de vista vinícola los híbridos interespecíficos de Sac-charomyces kudriavzevii y Saccharomyces cariocanus con Saccharomyces cerevisiae. Se espera que estos hí-bridos aporten aromas multicapa diferenciadores en ciertos estilos de vinos.

Otro ejemplo de aplicación satisfactoria de estrategias sin modificación genética en nuestro programa de desarrollo de cepas es la producción y la comerciali-zación de cepas novedosas de Saccharomyces cerevi-siae con la capacidad de fermentar robustamente y de producir simultáneamente niveles óptimos de tioles afrutados deseables y cantidades mínimas de H

2S. En

primer lugar, la investigación de los beneficios de las estrategias de co-inoculación ha contribuido al desa-rrollo de dos productos comercializados mixtos (una mezcla de cepas de un proporción específica) que mejoran los aromas afrutados provenientes de tioles. En segundo lugar, se han utilizado estrategias sin mo-dificación genética para desarrollar cepas de vino que fermentan excepcionalmente bien sin producir can-tidades detectables de H

2S. Estas cepas comerciales

que producen menos H2S obtuvieron resultados ex-

celentes a escala industrial.

Con el fin de empezar a investigar las bases genéticas de las diferencias entre cepas de la levadura vínica, el Australian Wine Research Institute (Instituto de Inves-tigación Enológica de Australia) obtuvo el genoma de una cepa de levadura vinícola y lo comparó con el de la cepa de Saccharomyces cerevisiae de laboratorio. La cepa de vino resultó ser muy diferente a su homóloga de laboratorio. La secuenciación del genoma de otras cepas industriales proporcionará una visión más pro-funda de las variaciones presentes en las cepas viníco-las y debería resaltar variaciones comunes y específi-cas de cepas que puedan asociarse con características industriales importantes.

Así como las investigaciones fundamentales sobre le-vaduras pasaron de estrategias clásicas reduccionista a estudios que implican todo el genoma, estos últimos pasarán también al siguiente nivel de investigación biológica conocido como la biología de sistemas. La denominada revolución -ómica promete, con la ayu-da de modelos matemáticos, la consecución de una comprensión total de las células de la levadura vínica en toda su complejidad. Esta metodología permitirá el

24

Seminario técnico


desarrollo de cepas con una precisión y velocidad sin rival, y facilitará la utilización a medida del metabolis-mo de la levadura para satisfacer las cada vez mayores demandas de los vinicultores y las preferencias siem-pre cambiantes de los consumidores en un mercado masificado y sobre-abastecido.

7. Conclusiones y previsiones futurasEn conclusión, el sector enológico y sus organismos de investigación están continuamente profundizando en el conocimiento de las interacciones entre nutrien-tes, los precursores de sabores derivados de la uva, las condiciones de fermentación y las cepas específicas de levaduras para la producción del vino. Existen mu-chas oportunidades innovadoras abiertas para inves-tigaciones futuras. El sector del vino se centrará en el desarrollo de la evaluación de nutrientes rápidos y el control de la fermentación a través de técnicas ante-riormente inimaginables como la tecnología del infra-rrojo cercano en línea. También mejorarán las cepas especializadas de la levadura vinícola y las estrategias de inoculación que puedan potenciar los caracteres deseables – los vinicultores ahora buscan cepas de bajo alcohol, tolerantes al etanol y potenciadoras de sabores deseables, con capacidades bioconservantes y biosaludables para satisfacer las demandas espera-

das del mercado en el futuro — y reducir o eliminar sabores y aromas indeseables.

8. agradecimientos

El Australian Wine Research Institute Ltd (AWRI, Ins-tituto de Investigación Enológica de Australia), un miembro del Wine Innovation Cluster (Grupo de In-novación del Vino) de Adelaida, recibe el apoyo de viticultores y vinicultores australianos a través de su agencia de inversiones, la Grape and Wine Research and Development Corporation (Corporación para la Investigación y el Desarrollo de la Uva y el Vino), la cual lo financia según una metodología “matching funds” con el Gobierno australiano. Me gustaría agra-decer la contribución investigadora indicada en este documento a todos los miembros actuales y pasados del departamento de biociencia del AWRI: Caroline Abrahamse, Eveline Bartowsky, Jenny Bellon, Etjen Bi-zaj, Paul Chambers, Anthony Borneman, Antonio Cor-dente, Peter Costello, Chris Curtin, Angus Forgan, Paul Henschke, Wanphen Jitjaroen, Robyn Kievit, Ellie King, Dariusz Kutyna, Jane McCarthy, Jean Macintyre, Simon Schmidt, Tina Tran, Hentie Swiegers, Maurizio Ugliano, Cristian Varela y Gal Winter.

9. lecturas complementarias

1. Alexandre, H., P.J. Costello, F. Remize, J. Guzzo, & M. Guilloux-Benatier. 2004. Saccharomyces cerevi-siae–Oenococcus oeni interactions in wine: cu-rrent knowledge and perspectives. International Journal of Food Microbiology 93:141–154.

2. Bartowsky, E.J. & I.S. Pretorius. 2009. Microbial for-mation and modification of flavour and off-fla-vour compounds in wine. In: H. König, G. Unden & J. Frölich (eds.), Biology of Microorganisms on grapes, in must and wine. Springer, Heidelberg, Alemania. Capítulo 11, pp. 209-231.

3. Bataillon, M., A. Rico, J.-M. Sablayrolles, J. -M. Sal-mon & P. Barre. 1996. Early thiamin assimilation by yeasts under enological conditions: impact of alcoholic fermentation kinetics. Journal of Fer-mentation and Bioengineering 82:145–150.

4. Bauer, F.F. & I.S. Pretorius. 2000. Yeast stress res-ponse and fermentation efficiency: how to survi-ve the making of wine – A review. South African Journal of Enology and Viticulture 21:27-51.

5. Bell, S.J. & P.A. Henschke. 2005. Implications of nitrogen management for grapes and wine. Australian Journal of Grape and Wine Research 11:242-295.

6. Bellon, J., A. Heinrich & P. Chambers. 2006. Yeast research increases choice for winemakers and consumers. Australian & New Zealand Grape-grower & Winemaker (514):102-103.

7. Bellon, J., L. Rose, B. Currie, J. Ottawa, S. Bell, H. Mclean, C. Rayment, C. Treacher & P. Henschke. 2008 Summary from the winemaking with non-conventional yeasts workshops, 13th AWITC. Australian & New Zealand Grapegrower & Wine-maker (528):72-77.

8. Berthels, N.J., R.R. Cordero Otero, F.F. Bauer, I.S. Pretorius and J.M. Thevelein. 2008. Correlation between glucose/fructose discrepancy and hexokinase kinetic properties in different Sac-charomyces cerevisiae wine yeast strains. Applied Microbiology and Biotechnology 77:1083-1091.

9. Bisson, L.F. & C.E. Butzke. 2000. Diagnosis and rectification of stuck and sluggish fermentations. American Journal of Enology and Viticulture 51:168-177.

10. Bisson, L.F. 1999. Stuck and sluggish fermenta-tions. American Journal of Enology and Viticultu-re 50:107-119.

Pone

ncia

s

25


11. Bohlscheid, J.C., J.K. Fellman, X.D. Wand, D. Ansen & C.G. Edwards. 2007. The influence of nitrogen and biotin interactions on the performance of Saccharomyces in alcoholic fermentation. Jour-nal of Applied Microbiology 102:390–400.

12. Borneman, A.R., P.J. Chambers & I.S. Pretorius. 2007. Yeast Systems Biology: modelling the winemaker’s art. Trends in Biotechnology 25:349-355.

13. Borneman, A.R, P.J. Chambers & I.S. Pretorius. 2009. Systems biology as a platform for wine yeast strain development. In: H. König, G. Unden & J. Frölich (eds.), Biology of Microorganisms on grapes, in must and wine. Springer, Heidelberg, Alemania. Capítulo 22, pp. 395-414.

14. Borneman, A.R., A.H. Forgan, P.J. Chambers & I.S. Pretorius. 2008. Unravelling the genetic blueprint of wine yeast. Australian and New Zealand Wine Industry Journal 23:21-23.

15. Borneman, A.R., A. Forgan, P.J. Chambers & I.S. Pretorius. 2008. Comparative genome analysis of a Saccharomyces cerevisiae wine strain. FEMS Yeast Research 8:1185-1195.

16. Borneman, A.R, P.J. Chambers & I.S. Pretorius. 2009. The way forward: modelling the winemaker’s art using yeast systems biology. In: P. Romano & G.H. Fleet (eds.), Yeast in Wine Fermentation. Springer, Heidelberg, Alemania (en prensa).

17. Boulton, R.B., V.L. Singleton, L.F. Bisson & R.E. Kunkee. 1998. Principles and Practices of Wine-making. USA: Aspen Publishers, Inc.

18. Chambers, P.J., Bellon, J.R., Schmidt, S.A., Varela, C. & Pretorius, I.S. 2008. Non-genetic engineering approaches to isolating and generating novel yeasts for industrial applications. In: G. Kunze & T. Satyanarayana (eds.), Diversity and Potential Bio-technological Applications of Yeasts. Elsevier (en prensa).

19. Cordente, A.G., A. Heinrich, I.S. Pretorius & J.H. Swiegers. 2009. Isolation of sulfite reductase variants of a commercial wine yeast with signi-ficantly reduced hydrogen sulfide production. FEMS Yeast Research (en prensa).

20. Curtin, C.D., J.R. Bellon, A.D. Coulter, G.D. Cowey, E.M.C. Robinson, M.A. de Barros Lopes, P. W. Go-dden, P.A. Henschke & I.S. Pretorius. 2005. The six tribes of ‘Brett’ in Australia: Distribution of ge-netically divergent Dekkera bruxellensis strains across Australian winemaking regions. Australian and New Zealand Wine Industry Journal 20:28-35.267:159-166.

21. De Barros Lopes, M., J.R. Bellon, N.J. Shirley & P.F. Ganter. 2002. Evidence for multiple interspeci-fic hybridization in Saccharomyces sensu stricto species. FEMS Yeast Research 1:323-331.

22. Edwards, C. & J.C. Bohlscheid. 2007. Impact of pantothenic acid addition on H

2S production

by Saccharomyces cerevisiae under fermentati-ve conditions. Enzyme & Microbial Technology 41:1–4.

23. Eglinton, J.M. & P.A. Henschke. 1993. Can the addition of vitamins during fermentation be jus-tified? Australian Grapegrower and Winemaker (352):47–49,51–52.

24. Eglinton, J.M. & P.A. Henschke. 1999. Restarting incomplete fermentations: the effect of high concentrations of acetic acid. Australian Journal of Grape and Wine Research. 5:71–78.

25. Fleet, G.H. 2003. Yeast interactions and wine fla-vour. International Journal of Food Microbiology 86:11-22.

26. Gockowiak, H. & P.A. Henschke. 1992. Nitrogen composition of grape juice and implications for fermentation: results of a survey made in N-E Vic-toria. Australian & New Zealand Grapegrower& Winemaker (340):131, 133–138.

27. Henschke, P.A. 1997. Stuck fermentation: causes, prevention and cure. Allen, M.; Leske, P.; Baldwin, G., eds. Advances in juice clarification and yeast inoculation: proceedings of a seminar; 15 August 1996; Melbourne, Vic. Adelaide S.A: Australian So-ciety of Viticulture and Oenology; 1997: 30–38, 41.

28. Henschke, P.A. & V. Jiranek. 1991. Hydrogen sul-fide formation during fermentation: effect of ni-trogen composition in model grape must. Rantz, J.M., ed. Proceedings of the international sym-posium on nitrogen in grapes and wine; 18-19 June 1991; Seattle, Washington, USA. Davis, CA: American Society for Enology and Viticulture; pp. 172-184.

29. Houtman, A.C. & C.S. Du Plessis. 1981. The effect of juice clarity and several conditions promoting yeast growth on fermentation rate, the produc-tion of aroma components and wine quality. South African Journal of Enology and Viticulture 2:71–81.

30. Howell, K.S., J.H. Swiegers, G.M. Elsey, T.E. Siebert, E.J. Bartowsky, G.H. Fleet, I.S. Pretorius, & M.A. de Barros Lopes. 2004. Variation in 4-mercapto-4-methyl-pentan-2-one release by Saccharomyces cerevisiae commercial wine strains under diffe-

26

Seminario técnico


rent wine fermentation conditions. FEMS Micro-biology Letters 240: 125-129.

31. Jolly, N.P., O.P.H. Augustyn & I.S. Pretorius. 2006. The role and use of non-Saccharomyces yeasts in wine production. South African Journal of Enolo-gy and Viticulture 27:15-39.

32. King, E.S., J.H. Swiegers, B. Travis, I.L. Francis, S. Bas-tian & I.S Pretorius. 2008. Coinoculated fermenta-tions using Saccharomyces yeasts affect the vo-latile aroma composition and sensory properties of Vitis vinifera L. cv. Sauvignon Blanc wines. Jour-nal of Agricultural and Food Chemistry 56:10829-10837.

33. Le Jeune, C., M. Lollier, C. Demuyter, C. Erny, J.L. Legras, M. Aigle & I. Masneuf-Pomarede. 2007. Characterization of natural hybrids of Saccha-romyces cerevisiae and Saccharomyces bayanus var. uvarum. FEMS Yeast Research 7:540–549

34. Lilly, M., M.G. Lambrechts & I.S. Pretorius. 2000. The effect of increased yeast alcohol acetyltrans-ferase activity on the sensorial quality of wine and brandy. Applied and Environmental Micro-biology 66: 744-753.

35. Lilly, M., G. Styger, F.F. Bauer, M.G. Lambrechts & I.S. Pretorius. 2006. The effect of increased yeast branched-chain amino acid transaminase activi-ty and the production of higher alcohols on the flavor profiles of wine and distillates. FEMS Yeast Research 6:726-743.

36. Lilly, M., F.F. Bauer, M.G. Lambrechts, J.H. Swiegers, D. Cozzolino & I.S. Pretorius. 2006. The effect of increased alcohol acetyl transferase and esterase activity on flavor profiles of wine and distillates. Yeast 23:641-659.

37. Molina, A.M, J.H. Swiegers J.H, C. Varela, I.S. Preto-rius & E. Agosin. 2007. Influence of wine fermen-tation temperature on the synthesis of yeast-derived volatile aroma compounds. Applied Microbiology and Biotechnology

38. Monk, P.R. 1986. Rehydration and propagation of active dry wine yeast. Australian Wine Industry Journal 1:3-5.

39. Pretorius, I.S. 2000. Tailoring wine yeast for the new millennium: novel approaches to the an-cient art of winemaking. Yeast 16: 675-729.

40. Pretorius, I.S. & F.F. Bauer. 2002. Meeting the con-sumer challenge through genetically customi-sed wine yeast strains. Trends in Biotechnology 20:426-432.

41. Pretorius, I.S. & P.B. Høj. 2005. Grape and Wine Biotechnology: Challenges, opportunities and potential benefits. Australian Journal of Grape and Wine Research 11:83-108.

42. Renouf, V., A. Lonvaud-Funel & J. Coulon. 2007. The origin of Brettanomyces bruxellensis in wi-nes: A review. Journal International des Sciences de la Vigne et du Vin. 41:161-173.

43. Sablayrolles, J.M., C. Dubois, C. Manginot, J.L. Roustan & P. Barre. 1996. Effectiveness of combi-ned ammoniacal nitrogen and oxygen additions for completion of sluggish and stuck fermenta-tions. Journal of Fermentation and Bioenginee-ring 82:377-381.

44. Salmon, J.M. 1989. Effect of sugar transport in-activation in on sluggish and stuck oenological fermentations. Applied and Environmental Mi-crobiology 55:953-958.

45. Schmidt, S.A., T. Tran, P.J. Chambers, M.J. Herde-rich & I.S. Pretorius. 2006. Developing indicators of wine yeast performance: an overview of the impact of ethanol stress. Australian and New Zealand Wine Industry Journal 21:24-30.

46. Subileau, M., R. Schneider, J.-M. Salmon & E. Degryse. 2008. Nitrogen catabolite repression modulates the production of aromatic thiols characteristic of Sauvignon Blanc at the level of precursor transport. FEMS Yeast Research (en prensa).

47. Swiegers, J.H., E.J. Bartowsky, P.A. Henschke & I.S. Pretorius. 2005. Yeast and bacterial modulation of wine aroma and flavour. Australian Journal of Grape and Wine Research 11:139-173.

48. Swiegers, J.H., D. Capone, G. Elsey, M.A. Sefton, I.L. Francis, & I.S. Pretorius. 2007. Engineering volatile thiol release in Saccharomyces cerevisiae for im-proved wine aroma. Yeast 24:561-574.

49. Swiegers, J.H., I.L. Francis, M.J. Herderich, & I.S. Pretorius. 2006. Meeting consumer expectations through management in vineyard and winery: The choice of yeast for fermentation offers great potential to adjust the aroma of Sauvignon Blanc wine. Australian and New Zealand Wine Industry Journal 21:34-42.

50. Swiegers, J.H. & I.S. Pretorius. 2007. Modulation of volatile sulfur compounds by wine yeast. Applied Microbiology and Biotechnology 74:954-960.

51. Swiegers, H., M. Ugliano, T. van der Westhuizen & P. Bowyer. 2008. Impact of yeast rehydration on the aroma of Sauvignon Blanc wine. Austra-

Pone

ncia

s

27


lian & New Zealand. Grapegrower Winemaker (528):68–71.

52. Swiegers, J.H, S.M.G. Saerens & I.S. Pretorius I.S. 2008. The development of yeast strains as tools to adjust the flavour of fermented beverages to market specifications. In: D.H. Frenkel & F. Belan-ger (eds.), Biotechnology in Flavour Production. Blackwell Publishing, Oxford, Reino Unido. Capí-tulo 1, pp.1-55.

53. Swiegers J.H., R.L. Willmott, T.E. Siebert, K. Lattey, B.R. Bramley, I.L. Francis, E.S. King & I.S. Pretorius. 2009. The influence of yeast on the aroma of Sau-vignon Blanc wine. Food Microbiology 26:204-211.

54. Torrea, D., & P.A. Henschke. 2004. Ammonium su-pplementation of grape juice-effect on the aroma profile of a Chardonnay wine. Technical Review 150:59–63.

55. Ugliano, M., P.A. Henschke & I.S. Pretorius. 2007. Nitrogen management is critical for wine flavour and style. Australian and New Zealand Wine In-dustry Journal 22:24-30.

56. Vilanova, M., M. Ugliano, C. Varela, T. Siebert, I.S. Pretorius & P.A. Henschke. 2007. Assimilable ni-trogen utilisation and production of volatile and non-volatile compounds in chemically defined medium by Saccharomyces cerevisiae wine yeasts. Applied Microbiology and Biotechnology 77:145-157.

28

Seminario técnico


Pone

ncia

s

29

Contenido31 La reactividad del oxígeno en los vinos

32 La técnica de la micro-oxigenación

35 Bibliografía

03. la micro-oxigenación de vinos tintos: Control de la reducción y estabilización del color

Prof. encarna GóMez PlazaUniversidad de Murcia

Seminario técnico


la reactividad del oxígeno en los vinos

El oxigeno juega un papel importante en diversos procesos bioquímicos en los mostos y en los vinos, tanto durante la fermentación alcohólica como en postfermentación, e incluso durante el embotellado. Su presencia modifica el estado redox de los vinos, lo que conlleva cambios que pueden afectar positiva o negativamente a la calidad de los vinos. Para una co-rrecta gestión del oxígeno es necesario conocer como éste actúa en el vino, particularmente en el control de la actividad de las levaduras, manejo de los olores azu-frados y estabilización del color de los vinos tintos.

La presencia de oxígeno en el vino provoca una oxi-dación, un proceso donde hay una transferencia de electrones. En el vino, el oxígeno es reducido a ciertos intermedios y finalmente a H

2O2 y a H

2O Consideran-

do la cantidad de oxígeno que un vino puede tomar (de 60 a 600 ml/l, de acuerdo con Singleton, 1986), está claro que no hay otros compuestos oxidables en el vino en cantidad suficiente que no sean los com-puestos fenólicos. Por lo tanto, éstos serán los princi-pales implicados en los fenómenos de oxidación de los vinos.

El oxigeno tiene una limitada reactividad en su forma molecular. El potencial oxidante del oxigeno se debe a la generación de especies reactivas del oxígeno. Así, la transferencia inicial de un electrón lleva a la forma-ción de O

2- que al pH del vino existe como radical hi-

droxiperóxido. Este paso requiere un catalizador, pre-ferentemente un metal como Fe. La transferencia de un segundo electrón producirá un peróxido (en vino H

2O

2). La siguiente reducción crea un agente oxidan-

te incluso más reactivo que los anteriores, el radical hidroxilo. La última reacción produce agua como pro-ducto final de la reducción del oxígeno

Adaptado de Waterhouse y Laurie, 2006

Los radicales formados durante este proceso interme-dio pueden ser directamente reducidos por los feno-les y son mejores oxidantes que el oxígeno (Water-house y Laurie, 2006).

Los principales productos secundarios de la reducción del oxígeno en el vino serán quinonas y aldehídos, fun-damentalmente el acetaldehído. Las quinonas pue-den participar en reacciones de polimerización que llevarán a la formación de grandes polímeros, normal-

Dra. encarna Gómez Plaza

Doctora por la Universidad de Murcia (1992). Fue be-caria predoctoral en el Departamento de Viticultura y Enología del CIDA (actual Instituto Murciano deInvestigación y Desarrollo Agroalimentario) siendoel tema de la tesis doctoral el estudio de los compo-nentes volátiles de uvas y vinos. Realizó su estancia post-doctoralenFresno(Califormia,EE.UU.),contra-tada por el Agricultural Research Service y la Califor-nia Raisin Advisory Board para realizar un proyecto de investigación sobre la presencia de tricloroaniso-lesenuvaspasas.VolvióaEspañaconuncontratodereincorporación de Doctores y Tecnólogos incorpo-rándosedenuevoalCIDAdondedurantetresañoscontinuó trabajando en uvas y vinos, centrándose en la caracterización polifenólica y cromática de éstos (1994-1996). Se incorporó a la Universidad de Murcia en 1997, primero como Profesor Ayudante, poste-riormentecomoProfesorTitulardeláreadeTecno-logía de Alimentos y desde el 2007 como Catedrática de Universidad. Ha dirigido numerosos proyectos de investigación con financiación regional y nacional, relacionadosconelestudiodeuvasyvinos.Esauto-ra de un alto número de publicaciones científicas en revistas tanto de divulgación como de alto impacto científico y revisora de algunas de las mejores revis-tas científicas de tecnología de alimentos.

Actualmente, su área de investigación se centra so-bre todo en el estudio de las características cromá-ticasdeuvasyvinos.Losdosúltimosproyectosenlos que se encuentra trabajando son el estudio del efecto de la micro-oxigenación de vinos y la crianza de estos (barrica y virutas) sobre la evolución y esta-bilidad del color y en el diseño de nuevas estrategias para la extracción de compuestos fenólicos de las uvas durante la vinificación.

Pone

ncia

s

31

03. La micro-oxigenación de vinos tintos: Control de la reducción y estabilización del color

mente de color pardo, responsables del pardeamien-to. Pero también, las quinonas pueden reaccionar y formar aductos con otros compuestos del vino, como los tioles, contribuyendo al control del problema de reducción en los vinos (Waterhouse y Laurie, 2006; Vi-dal y Aagaard, 2008). Los aldehídos, en el caso del vino tinto sobre todo, pueden participar en reacciones que serán de interés pues favorecen la estabilización del color de los vinos (Timberlake y Bridle, 1976).

Ya se había observado desde hace tiempo una dife-rencia importante entre los resultados en el vino de una oxidación lenta frente a una oxidación rápida, que sugiere la existencia de unas reacciones adicio-nales, que ocurren de forma lenta y que aumentan el conjunto de sustratos oxidables en el vino (Singleton, 1986). Así, lentamente, dos semiquinonas radicales se pueden unir covalentemente. Este proceso se llama polimerización regenerativa y lleva a la generación de una hidroquinona reoxidable. Tiene un potencial de reducción menor que sus constituyentes originales e incrementará la capacidad de tomar oxígeno del vino. Es decir, la polimerización regenerativa lenta lleva a unidades no oxidables (quinonas) a incorporarse en hidroquinonas reoxidables lo que incrementará los sustratos oxidables del vino y protegerá a los sustratos originales. Si el oxigeno se añade rápidamente, esta reacción no ocurre, se agotan también rápidamente los fenoles para reaccionar, con formación de muchas quinonas y, por tanto, el pardeamiento de los vinos.

la técnica de la micro-oxigenación

Estas observaciones pueden ser la base científica que explica los resultados de la micro-oxigenación, técni-ca que nació en la década de los 90. Está basada en el aporte controlado de pequeñas cantidades de oxíge-no al vino mediante un microdifusor poroso, de forma continua y lenta, siendo la velocidad de aporte de oxi-geno inferior a la velocidad de consumo, evitando la acumulación de éste en el vino. Los efectos positivos de la micro-oxigenación sobre los vinos tintos se pue-den resumir en:

• Estabilizacióndelcolor

• Reduccióndeoloresareducciónysaboresher-báceos

• Suavizacióndelvinopordisminucióndeastrin-gencia

Estos efectos se deben a la formación de esos produc-tos finales de la oxidación en los vinos. Así, las quino-nas formadas pueden fijar compuestos azufrados y contribuir a la disminución de los “olores a reducción” en los vinos. Además, las quinonas formadas pueden comenzar un proceso de polimerización de com-puestos fenólicos, lo que puede modificar el sabor y la astringencia de los vinos. De igual forma, otro de los productos que aparecen, el acetaldehído, partici-pa en las reacciones de estabilización de color de los vinos tintos a través de la formación de compuestos fenólicos unidos por puente de etilo (tanino-tanino y antociano-tanino fundamentalmente) y favoreciendo la formación de piranoantocianos, compuestos más estables que los antocianos nativos de los vinos.

a) Control de la reducción

Uno de los motivos por los que a este defecto se le lla-ma olor a reducción es por que normalmente aparece

Compuestos azufrados de bajo Pm Descripción del olor Umbral olfatorio (ppb)

Sulfuro de hidrógeno (H2S) Huevos podridos 1

Metanotiol (MeSH) Goma quemada, putrefacción 1,5

Etanotiol(EtSH) Cebolla, goma, terroso 1,5

Sulfuro de dimetilo (DMS) Col cocida, esparragos 25

Sulfurodedietilo(DES) Ajo, goma 1

Disulfuro de carbono (CS2) Dulce, goma, azufrado 5

Disulfuro de dimetilo (DMDS) Vegetal, col, cebolla (a alta concentración) 10

Disulfurodedietilo(DEDS) Olordesagradable,cebolla 4

Metil tioacetato (MeSAc) Azufrado, huevo, queso 40

Etiltioacetato(EtSAc) Azufrado, cebolla, ajo 70

Metionol Col cocida 1200

Adaptado de Vidal y Aagaard, 2008

Adaptado de Waterhouse y Laurie, 2006

32

Seminario técnico


cuando el potencial redox del vino es bajo y se debe normalmente a la aparición de compuestos azufrados volátiles, generalmente descritos como olor a goma quemada, pútridos, huevos podridos, cebolla, col, ajo..... aunque no hay que olvidar que entre los com-puestos azufrados volatiles existen algunos como el 3-mercaptohexanol o 3-mercaptohexil acetato que imparten aromas afrutado positivos al vino (Zoec-klein, 2006).

El azufre tiene varias formas reducidas en el vino:

- H2S, que se produce naturalmente durante la fer-

mentación alcohólica y cuya formación se debe in-tentar controlar, sobre todo al final de la fermentación alcohólica o formará otros compuestos azufrados,

- los tioles, que se forman normalmente al final del fermentación alcohólica y en postfermentación y po-seen un umbral de percepción bastante bajo y,

- sulfuros y disulfuros, que se forman durante todo el proceso de vinificación y por la oxidación de tioles en vinos terminados, tienen los umbrales de percepción mas altos por lo que son menos problemáticos pero son más difíciles de eliminar y en botella pueden re-vertir a tioles.

El H2S es un intermediario en la biosíntesis de com-

puestos azufrados requeridos por las células para el crecimiento celular y su funcionamiento. El azufre en forma de SO

42-, S, SO

32- entra en la célula y se redu-

ce a sulfuro a través de dos pasos activados por ATP. En este momento el sulfuro se combina enzimatica-mente con precursores que contienen nitrógeno para formar cisteina y metionina. En ausencia de nitrógeno intracelular lo que se forma es un exceso de H2S que no se incorpora a los aminoácidos sino que se libera al vino (Zoecklein, 2006). En otros casos, un suministro suficiente de nitrógeno también puede llevar a altas cantidades de H2S, debido a la carencia de otros nu-trientes y otros efectos no tan conocidos.

Hay una serie de medidas que se pueden tomar para intentar controlar la formación de estos compuestos azufrados, tanto antes de la fermentación alcohólica (evitar uvas tratadas con S o Cu en fechas cercanas a vendimia, añadir cantidades justas de SO

2), como

en las primeras etapas de la fermentación alcohólica (utilizar nutrientes para las levaduras y cepas seguras, temperaturas moderadas de fermentación) y en las últimas etapas de fermentación (evitar el uso de SO2, mantener la sanidad de las levaduras..).

También el oxígeno puede tener un papel importante en este control. El oxigeno añadido al mosto en fer-mentación (como macro-oxigenación o micro-oxige-nación) limita el impacto de compuestos azufrados volátiles de dos formas: a) permitiendo que la leva-dura sintetice ácidos grasos y esteroles y así soporta

mejor el estrés y b) incrementando el potencial redox y reduciendo la presencia de azufrados volátiles. Otro efecto del oxígeno es que puede reaccionar con el H2S y formar S y agua. El azufre se eliminará después por medio de los trasiegos.

En postfermentación también se puede utilizar el oxí-geno para controlar los problemas de reducción y los compuestos azufrados volátiles. Los compuestos azu-frados son sensibles al oxígeno y el aporte de oxígeno reducirá su concentración. Comúnmente se acepta que la reacción que ocurre es (Zoecklein, 2007):

O2

CH3-SH H3C-S-S-CH3

0.2 ppb 12 ppb

Como se observa, los compuestos azufrados no des-aparecen sino cambian a otras formas con umbrales de percepción más altos. Pero esta reacción es rever-sible y en ambiente reductor se puede volver a formar tioles.

Pero no hay que olvidar que otra reacción es posible en presencia de oxígeno y es la reacción entre las qui-nonas formadas por oxidación de fenoles con los gru-pos –SH de los compuestos azufrados (Waterhouse y Laurie, 2006).

Así, estudios realizados micro-oxigenando vinos tintos han mostrado que los vinos con micro-oxigenación tenían menos niveles de metanotiol y etanotiol que los vinos testigo, disminuyendo su concentración por debajo de su umbral aromático y además no se detec-tó acumulación de disulfuros (McCord, 2003).

Es muy importante mantener el suficiente aporte de oxigeno para producir continuamente quinonas que atrapen las nuevas moléculas azufradas que se pue-den ir formando durante el envejecimiento del vino, tanto por hidrólisis de tioésteres o por condiciones anaerobias.

b) Mejora de la estabilidad del colorLa importancia del oxígeno en la evolución del color del vino tinto ya se conoce desde hace tiempo, tan-to con respecto a la oxidación de polifenoles como la la formación de nuevos compuestos más estables derivados de los antocianos. Entre las reacciones que ocurren como consecuencia de la presencia de oxí-geno hay que incluir los cambios en la longitud de las cadenas de taninos, que afecta a la astringencia, y la formación de piranantocianos y compuestos unidos por puente de etilo (por la presencia de acetaldehído)

Pone

ncia

s

33

03. La micro-oxigenación de vinos tintos: Control de la reducción y estabilización del color

que son mas estables que los antocianos originales, dando lugar a una mayor estabilidad e intensidad del color de los vinos micro-oxigenados (Timberlake y Bri-dle, 1976; Francia-Aricha et al., 1997; Salas et al., 2004).

La correcta aplicación de la técnica para conseguir los mayores beneficios va a depender del periodo de aplicación y el tipo de vino a micro-oxigenar. Funda-mentalmente, las mayores ventajas las vamos a encon-trar cuando el vino esté equilibrado, la proporción de

antocianos-taninos sea correcta y haya una cantidad importante de antocianos libres. Si no hay suficientes antocianos libres en el vino para reaccionar se puede acumular acetaldehído y verse favorecida la polimeri-zación de taninos, hasta que las moléculas formadas sean tan grandes que precipiten. Los diversos ensayos realizados han puesto de manifiesto que la etapa com-prendida entre fermentación alcohólica y fermentación maloláctica es la que mejores resultados suele dar por una alta presencia de antocianos libres, ácido pirúvico y ausencia de SO

2. Esto se observa en los trabajos de

Cano-López et al. (2006), donde se ha puesto de mani-fiesto que se observa un incremento en la intensidad de color fundamentalmente en el primer periodo de microoxigenación (entre la fermentación alcohólica y el inicio de la fermentación maloláctica) en los vinos microoxigenados. Al finalizar la fermentación malo-láctica se observó en todos ellos un descenso, pro-bablemente consecuencia de la variación del pH y la precipitación de materia coloidal que arrastra materia colorante. Aunque el aporte de oxigeno durante el se-gundo periodo (se comenzó cuando la fermentación alcohólica ya esta finalizada) fue menor, se observó de nuevo un aumento de intensidad de color en los vinos microoxigenados, diferenciándose todos los vinos en color, y observándose también el efecto de la dosis de oxígeno aplicada. El incremento de color se adscribió a una mayor concentración de piranoantocianos y com-

Compuestos identificados t0 tf

Control Control Dosis 1 Dosis 2

Antocianosmonoméricos(mgL-1) 277.9±4.2c 185±0.9b 178±7.4b 159±16.1a

Aductosdirectos(µgL-1) 1900±87a 2121±51b 1945±84a 1858±110a

SumadePiranoantocianos 14872±374b 9974±225a 14524±99b 14091±16b

Compuestosunidosporetilo(µgL-1) 5008±46a 5503±14a 5883±18b 6262±145c

Picopolimérico(mgL-1) 19.7±0.2a 19.2±0.7a 21.6±2ab 23.4±1.1b

Concentración de las principales familias de antocianos y compuestos derivados en vinos de Monastrell micro-oxigenados (Cano-lópez et al., 2006).

Figura. evolución del grado medio de polimerización de los taninos en vinos micro-oxigenados y sus correspondientes testigos (W1: vino de bajo contenido polifenólico, W2: vino de contenido polifenólico

medio, W3: vino de alto contenido polifenólico). adaptado de Cano-lópez et al. 2008

Figura. Comparación de la concentración de etanotiol, metanotiol y dimetilsulfuro en vinos control, micro-oxigenados, micro-oxigenados y con aplicación de duelas de roble y micro-

oxigenados y con aplicación de segmentos de roble (adaptado de McCord, 2003).

34

Seminario técnico


puestos unidos por puente de etilo en los vinos micro-oxigenados (Cano-López et al., 2006).

También los efectos de la micro-oxigenación sobre los taninos del vino han sido estudiados (Cano-López et al., 2008). Se han observado diferentes comporta-mientos con respecto a la evolución del grado me-dio de polimerización. Este parámetro siempre se in-crementa en el primer periodo (fin de fermentación alcohólica-inicio de fermentación maloláctica) para

evolución desde final de fermentación alcohólica hasta la finalización del proceso de micro-

oxigenación de la intensidad de color en vinos (no se aplicó la micro-oxigenación durante la

fermentación maloláctica)

todos los vinos y después cae, excepto para el vino de contenido fenólico bajo. Este incremento se corres-ponde a la fase estructurante descrita en las observa-ciones empíricas y suele ocurrir incluso cuando no se está aplicando oxigeno al vino. La reducción que se observa después, principalmente en los vinos de con-tenido fenólico medio y alto micro-oxigenados puede ser debido a un rearreglo estructural de los taninos a formas mas cortas, y ésto se asocia a un descenso en astringencia. También la reacción de estas cadenas mas cortas con antocianos reducirá la astringencia. El comportamiento diferente del vino de contenido fe-nólico bajo microoxigenado puede estar relacionado con una sobre-oxigenación del vino, debido a su bajo contenido en antocianos libres.

El conjunto de observaciones realizadas en el trabajo de Cano-López et al. (2008) pone de manifiesto como la micro-oxigenación mejora las características de los vinos de mas alto contenido fenólico por tener altas cantidades de antocianos libres, incrementándose su color y mejorando notablemente su estructura.

Todas estas observaciones nos llevan a concluir que la micro-oxigenación es una técnica de aplicación muy interesante en vinos tintos, sobre todo en vinos con potencial fenólico. No acelera el envejecimiento pero si lo puede optimizar y ayudar a controlar problemas de reducción en los vinos.

BibliografíaCano-lópez, M.; Pardo-Mínguez, F.; lópez-roca, J.M.; Gómez-Plaza, e. (2006). Effect of microoxyge-nation on anthocyanin and derived pigment content and chromatic characteristics of red wines. American Journal of Enology and Viticulture 57, 325-331.

Cano-lópez, M.; Pardo-Mínguez, F.; Schmauch, G.; Saucier, C.; teissedre, C.; lópez-roca, J.M.; Gómez-Plaza, e. (2008). Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contents. Journal of Agricultural and Food Chemistry, 56, 5932-5941

Francia-aricha, e.; Guerra, M.t.; rivas-Gonzalo, J.; Santos-Buelga, C. (1997). New anthocyanin pig-ments formed after condensation with flavanols. Jour-nal of Agricultural and Food Chemistry, 45, 2262-2266.

rauhut. D (2002). Volatile sulfur compounds. Impact on reduced sulfur flavor defects and atypical aging in wine. 31st Annual New York Wine Industry Conferen-ce.

Salas, e.; atanasova, V.; Poncet-legrand, e.; Meu-dec, e.; Mazauriz, J.; Cheynier, V. (2004). Demostra-tion of occurrence of flavanol-anthocyanin adducts in wine and model solutions. Analytica Chimica Acta, 213, 367-370.

Singleton, V. (1987). Oxygen with phenols and rela-ted reactions in musts, wines and model systems. Ob-servations and practical implications. American Journal of Enology and Viticulture, 38, 69-77.

timberlake, C.; Bridle, P. (1976). Interaction bet-ween anthocyanins, phenolic compounds and acetal-dehyde and their significance in red wines. American Journal of Enology and Viticulture, 27, 97-105.

Vidal, S., aagaard, O. (2008). Oxygen management during vinification and storage of Shiraz wine. Wine Industry Journal, 23, www. Winebiz.com.au

Waterhousse, a.; laurie, F. (2006). Oxidation of wine phenolics. A critical evaluation and hypothesis. Ameri-can Journal of Enology and Viticulture, 57, 306-312.

Zoecklein, B. (2006). Sulfur compounds: impact on aroma, flavor and texture and practical management. Enology notes, 113

Zoecklein, B. (2007). Factors impacting sulfur-like off odors in wine and winery options. 8th Annual Enolo-gy and Viticulture British Columbia Wine Grape Council Conference.

Pone

ncia

s

35

04. ¡los compuestos volátiles no son todos perjudiciales! los tioles varietales y el sulfuro de dimetiloRémi GUeRin-SCHneiDeRinstitut Français de la Vigne et du Vin entaV-itV France

Contenido38 1. Los tioles varietales

39 2. El sulfuro de dimetilo

40 Conclusión

Seminario técnico


Rémi Guerin-Schneider

IngenieroAgrónomoyEnólogo,Schneider, completa su forma-ción con una Tesis Doctoral, en el año 2001, sobre el potencial aro-mático de los vinos de Muscadet. IngenierodeInvestigaciónyDe-sarrolloelInstitutofrancésdelaViña y del Vino desde 2001, está encargadodelProyecto“Útilesymétodos de caracterización de la calidad de uvas y vinos”

Particularmente especializadoen el análisis de compuestos aromáticos de vinos y de sus precursores, Remi Schneider, es autor de numerosas publicacio-nes científicas centradas en la puesta apunto de metodologías analíticas sensibles y fiables, particularmente empleando di-lución isotópica, así como méto-dos de estimación del potencial aromático de uvas procedentes de viñedos de alta producción.

Desde el año 2006, coordina un programa de investigación (UMT « Qualinnov ») agrupando equi-posdeelINRAydelIFV.

Publicaciones principalesR. SCHNEIDER, A. RAZUNGLES, C. AUGIER, R. BAUMES, 2001. Monoter-penicandNorisoprenoidicGlycoconjugatesofVitisviniferaL.cv.MelonB.asPrecursorsofOdorantsinMuscadetWines.J.Chromatogr.,936,145-147.

R. SCHNEIDER, A. RAZUNGLES, F. CHARRIER, R. BAUMES, 2002. Effetdusite, de la maturité, et de l’éclairement des grappes sur la composition aro-matiquedesbaiesdeVitisviniferaL.cv.MelonB.danslevignobleduMusca-det.Bulletindel’OIV,855-856,269-283.

A. BELANCIC-MAJCENOVIC, R. SCHNEIDER, J.P. LEPOUTRE, V. LEMPE-REUR, R. BAUMES, 2002. Synthesis and Stable IsotopeDilutionAssay ofEthanethiolandDiethylSulfideinWineusingSolidPhaseMicroextraction.EffectofAgingontheirLevelsinWine.J.Agric.FoodChem.,50,6653-6658.

R. SCHNEIDER, Y. KOTSERIDIS, J.L. RAY, C. AUGIER, R. BAUMES, 2003. QuantitativeDeterminationofSulfur-ContainingWineOdorantsatsub-ppbLevels.Part II :DevelopmentandApplicationofaStable IsotopeDilutionAssay.J.Agric.FoodChem.,51,3243-3248.

R. SCHNEIDER, F. CHARRIER, M. MOUTOUNET, R. BAUMES, 2004. Rapid AnalysisofGrapeAromaGlycoconjugatesusingFourrier-TransformInfraredSpectrometry and Chemometric Techniques. Analytica Chimica Acta, 513, 91-96.

C. PROUTEAU, R. SCHNEIDER, Y. LUCCHESE, F. NEPVEU, R. RENARD, C. VACA-GARCIA, 2004. ImprovingHeadspaceSolidphaseMicroextractionof3-Isobutyl-2-methoxypyrazinebyExperimentalDesignwithRegardtoSta-ble IsotopeDilutionGasChromatography-MassSpectrometryAnalysisofWine.AnalyticaChimicaActa,513,223-227.

DÍAZ-MAROTO M.C., SCHNEIDER R., BAUMES R., 2005. Formation pa-thwaysofethylestersofbranchedshort-chainfattyacidsduringwineaging.J.Agric.FoodChem.,53,3503-3509.

DAGAN L., SCHNEIDER R., LEPOUTRE J.P., BAUMES R., 2006. Stability of sotolon in acidic and basic aqueous solutions. Application to the synthesis ofadeuteratedanalogueforitsquantitativedeterminationinwine.Analyti-ca Chimica Acta, 563, 365-374.

SCHNEIDER R., CHARRIER F.,RAZUNGLES A., BAUMES R., 2006. Evidencefor an alternativebiogenetic pathway leading to 3-mercaptohexanol and4-mercapto-4-methylpentan-2-one inwines. Analytica Chimica Acta, 563,58-64.

M. SUBILEAU, R. SCHNEIDER, JM. SALMON, E. DEGRYSE, 2008 Nitrogen catabolite repression modulates the production of aromatic thiols characte-risticofSauvignonBlancatthelevelofprecursortransport,FEMSYeastRes,8, 771–780

Pone

ncia

s

37

04. ¡Los compuestos volátiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetilo

Los compuestos azufrados volátiles están presentes en gran número en los vinos. Se acostumbra a sepa-rarlos en dos clases distintas, los compuestos sulfuro-sos ligeros, cuyo punto de ebullición es inferior a 90ºC, y los compuestos sulfurosos pesados que presentan un punto de ebullición más elevado. Esta clasificación, práctica por su simplicidad, aporta sin embargo esca-sa información acerca de la naturaleza de los com-puestos y de su origen.

Si nos adentramos con más detalle en el tema, en-contramos tres grandes familias de compuestos en términos de estructura química: los tioles, los mono-o polisulfuros y los tiol-éster.

De manera general, las funciones químicas azufradas confieren a estos compuestos olores desagradables, intensos, que son percibidos negativamente. No obs-tante, cuando su peso molecular aumenta, el efecto negativo del grupo funcional sulfuroso se atenúa y las percepciones olfativas de los compuestos son más agradables. Así pues, la mayor parte de los compuestos sulfurosos ligeros, principalmente en productos en cur-so de fermentación son perjudiciales para la calidad del aroma, mientras que los compuestos sulfurados más pesados, pueden contribuir de manera favorable a me-jorar el perfil aromático de los vinos. Es concretamente el caso de los tioles varietales (Tominaga et al. 1998) y del sulfuro de dimetilo (Ségurel, 2005).

1. los tioles varietales

Los compuestos sulfurosos varietales se forman du-rante la fermentación a partir de los S- conjugados a la cisteina de la uva. Estos S-conjugados a la L-cisteina o precursores cisteinicos han sido evidenciados e iden-tificados directamente en la uva recientemente (Da-rriet et al., 1993; Tominaga et al., 1995; Tominaga et al., 1998b). Únicamente 3 de estos precursores han sido identificados formalmente en la uva : la S-(1-hidroxi-hex-3-yl)-L-cisteina (P3MH), el S-(4-metil-2-oxopent-4-yl)-L-cisteina (P4MMP) y el S-(4-metill-2-hidroxipent-4-yl)-L-cisteina (P4MMPOH ; (Tominaga et al., 1995; Tominaga et al., 1998b). Este último interviene rara-mente en el aroma del futuro vino.

Debido a las dificultades analíticas han sido publicados pocos datos cuantitativos acerca de los S-conjugados a la cisteina. Sus contenidos son reducidos y no supe-ran la centena de ug/L en caso del P3MH, el más abun-dante, en el mosto del Sauvignon Blanc, (Peyrot des Gachons et al., 2000; Peyrot des Gachons et al., 2002a; Peyrot des Gachons et al., 2005 Dagan, 2006). En cuan-to a sus evoluciones durante la maduración de la uva, se muestran variables en función del precursor y de la añada (Peyrot des Gachons et al., 2000, Dagan, 2006).

En la baya de la uva, la P4MMP se reparte por igual en la piel y en la pulpa mientras que el P3MH está mayo-

ritariamente presente en la piel (Murat et al., 2001b; Peyrot des Gachons et al., 2002a). Así pues, la mace-ración pelicular afecta principalmente al P3MH, cuyas cantidades recuperadas en el mosto son más impor-tantes en relación a una vinificación clásica (Murat et al., 2001b; Peyrot des Gachons et al., 2002a).

Cabe señalar igualmente la presencia en los mostos de Sauvignon Blanc de un conjugado del 3 mercap-tohexanol o glutathion que será el precursor bioge-nético del conjugado a la cisteina correspondiente, por hidrólisis de los dos aminoácidos asociados a la cisteina del glutation (Peyrot des Gachons et al., 2001). Más recientemente (Fedrizzi et al, 2009) un conjugado de la 4MMP al glutathion, ha sido formalmente identi-ficado en un mosto de Sauvignon.

Aún que poco abundantes y poco numerosos, es-tos precursores cisteinicos contribuyen sin embargo en gran manera al aroma del vino. Son en efecto el origen de cuatro tioles extremadamente olorosos, ausentes en la uva, pero responsables en el vino de notas olfativas reconocibles cuando sus contenidos son los suficientes el 3-sulfanilhexan-1-ol (3MH), el acetato de 3-sulfanylhexyle (ac3MH), el 4-metil-4-sul-fanilpentan-2-one (4MMP), presentando umbrales de percepción olfativa muy bajos, respectivamente de 60 ng/L, 4,2 ng/L y 0,8 ng/L en solución hidroalcohólica (Tominaga et al., 2000). Estos presentan respectiva-mente olores de pomelo, de corteza de cítricos y de boj, que participan de manera importante en el afru-tado de numerosos vinos blancos y rosados.

Si la 4MMP parece específica de un reducido núme-ro de variedades (Sauvignon, Bacchus, Scheurebe), el 3-sulfanyl-hexanol y su acetato han sido observados en un gran número de variedades. Estos participan no solamente en el aroma de los vinos de numerosas variedades blancas como pueden ser la Gewürztra-miner, Scheurebe, Colombard, Petit Manseng, Melon Blanc sino igualmente en tintas, como en la Garnacha, Merlot, Cabernet franc, Cabernet Sauvignon, Syrah, Mourvèdre, Cinsault (Darriet et al., 1993; Darriet et al., 1995; Güth, 1997a; Tominaga et al., 2000; Tominaga et al., 1996; Güth, 1997a; Bouchilloux et al., 1998; Kotse-ridis et Baumes, 2000; Lopez et al., 2003; Murat et al., 2003; Schneider et al., 2003; Fretz et al., 2005, Ferrei-ra et al., 2002, Schneider et Masson, 2009). Estudios recientes (Ferreira et al 2002; Masson et Schneider, 2009), han demostrado que el mercaptohexanol era por otra parte un aroma clave en los vinos rosados de Garnacha, y más concretamente en los Rosados de Provence (Masson et Schneider, 2009).

Esta ubicuidad del 3MH es en parte debida a una segunda vía de formación de este tiol durante la fer-mentación, no proveniente de S-conjugados a la cis-teina de la uva, sino al añadido de fuentes sulfurosas al (E)-2-hexenal en un mosto en fermentación (Schnei-der et al., 2006). Esta vía de formación ha sido por otra

38

Seminario técnico


parte demostrada en las mismas condiciones para el 4-metil-4-sulfanil-pentan-2-one vía oxido de mesitilo, pero este último o su hidrato no ha sido jamás encon-trado en la uva. Vías análogas han sido por otra parte evidenciadas para el 2-furanmetanetiol (umbral de percepción olfativa de 5ng/l en el vino tinto), respon-sable de las notas de café tostado de los vinos elabo-rados en barricas de roble (Blanchard, 2001), y podrían explicar la formación de otros tioles olorosos del vino, como el 3-mercapto-3-metilbutan-1-ol.

Es durante la fermentación cuando la levadura, por intervención de las enzimas de tipo liasa, libera los tioles olorosos por ruptura de la asociación C-S de la parte cisteina de los precursores cisteinicos de la uva (Tominaga et al., 1998b). Los rendimientos de trans-formación de los precursores cisteinicos al final de la fermentación en diferentes cepas de levadura Saccha-romyces cerevisiae son débiles y variables, indepen-dientemente de cual sea el precursor estudiado en el medio de muestra o natural, aunque la mayor parte de los precursores iniciales se hayan degradado : de 0,06% a 0,6% para la P4MMP (Murat et al., 2001a), y de 0,6% a 10,2 % para el P3MH ( Murat et al., 2001b). En lo relativo al ac3MH que no tiene en la uva ningún S-conjugado a la cisteina, es igualmente la levadura quien lo forma mediante acetilación del 3MH, al igual que ésta acetila los alcoholes de su metabolismo ni-trogenado. Así pues, la formación de estos tioles por la levadura depende mucho de la cepa de levadura, del mosto y de las condiciones de fermentación e incluso de algunas cepas salvajes de Saccharomyces bayanus var. Uvarum eran especialmente activas (Murat et al., 2001a; Masneuf et al., 2002; Howell et al., 2004; Du-bourdieu et al., 2006 ; Masneuf-Pomarede et al., 2006, Subileau, 2008).

En lo relativo a la evolución de estos tioles olorosos durante la conservación del vino, sus contenidos disminuyen generalmente, pero esta disminución depende en gran parte de los fenómenos de oxida-ción ligados a esta conservación. Así los factores que previenen la alteración del potencial reductor del vino (contacto limitado con el oxigeno, dióxido de azufre, lías, glutathion, antocianos) limitan estas pérdidas en tioles olorosos (Murat et al., 2003).

2. el sulfuro de dimetilo

El sulfuro de dimetilo (DMS) es un compuesto sulfuro-so ligero evidenciado por Du Plessis et Loubster (1974) en el vino, en el que sus umbrales de percepción olfa-tiva eran del orden de 25 µg/l. Sus contenidos en los vinos jóvenes eran más bien inferiores a este umbral, pero podían alcanzar los 900 µg/l en vinos más evo-lucionados (Dagan 2006 y referencia mencionada). El DMS es uno de los constituyentes importantes del aroma de trufas, una nota olfativa a menudo citada para el bouquet de reducción de los grandes vinos

tintos y de los vinos de vendimia tardía (Du Plessis e t Loubster, 1974; Spedding et Raut, 1982; Anocibar-Beloqui, 1998). En los vinos tintos, de débil concentra-ción parece amplificar las notas de frutas rojas, mien-tras que en fuertes concentraciones, contribuye a las notas de garriga, olivas y trufas (Ségurel, 2005; Escudro et al, 2007). Contrariamente sería percibido más bien de manera negativa en los vinos blancos (Goniak et Noble, 1987).

Durante la fermentación, el DMS es liberado por la acción de las levaduras a partir de aminoácidos azu-frados, en especial la cisteina, el glutation, la S-adeno-silmetionina (Schreier et al., 1974; De Mora et al., 1986; Anocibar Beloqui, 1998). Sin embargo, el DMS produ-cido por las fermentaciones es en gran medida elimi-nado por arrastre por el CO2, ya que es muy volátil (punto de ebullición 37°C/1 atm). Así pues, sus conte-nidos en los vinos en proceso de finalizar su fermenta-ción son generalmente muy inferiores a su umbral de percepción, pero pueden producirse en cantidades elevadas, asociados a otros compuestos azufrados ligeros nauseabundos, en los vinos que presentan el defecto de olor a reducción (Park et al., 1994).

No obstante, algunos trabajos han mostrado que los contenidos en DMS se incrementan con el tiempo y la temperatura durante el proceso de envejecimien-to en botella, hasta llegar ha alcanzar contenidos del orden de mg/L, (Marais, 1979; De Mora et al., 1986; De Mora et al., 1993; Anocibar Beloqui, 1998; Ségurel et al., 2004; Dagan, 2006). El DMS así producido durante en el envejecimiento, sería percibido de manera favo-rable en la génesis del bouquet de reducción de los grandes vinos tintos y de los vinos de vendimia tardía, contrariamente a su percepción en los vinos blancos jóvenes (ver más arriba). Estas informaciones sensoria-les son sin embargo bastante limitadas y deberán ser completadas para el conjunto de las variedades y de sus diferentes tipos de vino.

Por otra parte, un método de mediad de los precur-sores del DMS en el vino ha sido recientemente desa-rrollado, (Ségurel et al., 2005), el cual realiza una esti-mación correcta del DMS susceptible de ser liberado en el vino durante el envejecimiento (Ségurel et al., 2005). Además, estos trabajos han demostrado que la uva posee igualmente un PDMS. Entre los deriva-dos del metil-sulfonium a día de hoy conocido en las plantas (Howard et Russell, 1997), únicamente el SMM podría ser el precursor del DMS, presente en la uva, la SMM sería transmitida al vino, donde liberaría DMS por medio de una reacción de degradación quí-mica durante su conservación. La formación de DMS seguiría un proceso químico lento, dependiendo de la duración y de las condiciones de conservación. De esta manera, las diferencias en las concentraciones de DMS para vinos de edades equivalentes, se explica-rían esencialmente por las diferencias de PDMS inicial en el embotellado.

Pone

ncia

s

39

04. ¡Los compuestos volátiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetilo

Los análisis de uvas efectuados a día de hoy han reve-lado un potencial en DMS extremadamente hetero-géneo, y a veces muy elevado en algunas muestras de uva de la variedad Petit y Gros Manseng en estado de sobremaduración, de hasta 4,5 mg/L (Dagan, 2006), mucho más elevado que los contenidos encontrados en la Garnacha y el Syrah en maduración tecnológica (Ségurel et al., 2004). Para las muestras de estas cua-tro variedades, las únicas estudiadas a día de hoy, el PDMS es dependiente de la variedad, del terreno y de la añada, y sus contenidos aumentan de manera muy importante en estado de sobremaduración en el caso de la variedad Manseng, los únicos estudios realiza-dos a día de hoy para este parámetro. Sin embargo, en algunas de las muestras de estas cuatro variedades, el PDMS de las uvas, quizás mucho más elevado que en los vinos correspondientes, la simple degradación quí-mica no puede explicar estas pérdidas a veces consi-derables de transmisión de PDMS. Las causas de estas pérdidas son a día de hoy desconocidas, pero existen varias hipótesis que podrían explicarlas. La hipótesis de la degradación de la SMM por las levaduras es muy plausible, ya que ha sido descubierta recientemente una nueva permeasa, capaz de transportar de manera específica la SMM, que permitiría a la Saccharomy-ces cerevisiae utilizar la SMM como fuente de azufre (Rouillon et al., 1999), pero la evolución de la SMM en la levadura no ha sido todavía estudiada. Sea cual sea, el DMS formado sería casi enteramente eliminado por arrastre por el gas carbónico durante la fermentación

alcohólica o mediante simple vaporización mientras el vino no esté en un medio cerrado.

ConclusiónLos compuestos sulfurados juegan un papel impor-tante en el aroma de los vinos. Si los compuestos sul-furados ligeros, excepto el DMS, son sistemáticamente vectores de defectos organolépticos cuando superan sus umbrales de detección olfativa, los compuestos sulfurados más pesados pueden conferir notas olfati-vas muy interesantes y refinadas. Es especialmente el caso de los tioles varietales, caracterizados por sus no-tas de cítricos y de boj de los Sauvignon, que de una manera general aportan frescor y afrutado a los vinos. El caso del DMS se muestra mucho más complejo si cabe, por una parte su efecto realzante en bajas con-centraciones, pero que en elevadas concentraciones puede ser percibido negativamente en algunos tipos de vinos blancos.

Así pues, disponemos a día de hoy de numerosos elementos tecnológicos para controlar y dominar los contenidos de estos compuestos en los vinos, no hay que olvidar que el aroma de un vino es un conjunto complejo, y que al exacerbar uno u otro de sus com-ponentes, nos arriesgamos a desequilibrar el perfil aromático y ofrecer simplemente una caricatura.

40

Seminario Técnico


Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen Consumption

Beltran, G.; Esteve-Zarzoso, B.; Rozès, N.; Mas, A. And Guillamón J.M.

Unitat d’Enologia del Centre de Referència de Tecnologia d’Aliments, Department Bioquímica i Biotecnologia, Facultat d’Enologia de Tarragona, Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005 Tarragona, Spain, and Bodegas Miguel Torres, Miquel Torres i Carbó 6, 08720 Vilafranca del Penedès, Barcelona, Spain

Nitrogen deficiencies in grape musts are one of the main causes of stuck or sluggish wine fermentations. In the present study, we have supplemented nitrogen-deficient fermentations with a mixture of ammonium and amino acids at various stages throughout the alcoholic fermen-tation. The timing of the nitrogen additions influenced the biomass yield, the fermentation performance, the patterns of ammonium and amino acid consumption, and the production of secondary metabolites. These ni-trogen additions induced a nitrogen-repressed situation in the cells, and this situation determined which nitrogen sources were selected. Glutamine and tryptophan were the main amino acids consumed in all the fermentations. Ammonium is the preferred nitrogen source for biomass production but was hardly consumed when it was added in the final stages of the fermentation. The higher am-monium consumption in some fermentations correlated with a greater synthesis of glycerol, acetate, and acetal-dehyde but with a lower synthesis of higher alcohols.

KEYWORDS: Saccharomyces cerevisiae; Alcoholic Fermentation; Amino acids; Ammonium; GAP1; MEP2

INTRODUCTION

The nitrogen composition of grape musts affects the growth and metabolism of yeast, the fermentation rate, and the completion of fermentation (1). Nitro-gen deficiencies are one of the main causes of stuck or sluggish fermentations. One way of avoiding these problems is to add nutritional supplements, usually inorganic forms of nitrogen such as ammonium salts, to grape must prior to fermentation (2-4). These addi-tions are generally made empirically in wine cellars, and the initial nitrogen concentration in the must or the nitrogen requirements of the usual yeast strain used in the cellar are not determined. Yeasts respond metabolically to differences in nitrogen availability, so this lack of control of nitrogen leads to differences in wine composition.

Nitrogen affects yeast cells in two ways: it increases biomass production and stimulates the rate of sugar utilization. Nitrogen additions during the period of cell growth have resulted in maximum cell populations. Later additions during the stationary phase have had no effect on the cell population but have increased the specific fermentation rate, thus reducing the leng-th of the fermentation (2, 5, 6).

Nitrogen supplementation affects the pattern of nitro-gen uptake. Ammonium is a preferred yeast nitrogen source, and when plentiful, it represses the expression of catabolic pathways by degrading other nitrogenous compounds (7, 8). This mechanism, called nitrogen catabolite repression (NCR), has recently been studied during wine fermentations (9). It inhibits the uptake of arginine and alanine and stimulates the consumption of branched-chain and aromatic amino acids. Changes in the nitrogen uptake patterns influence the produc-tion of aroma and spoilage compounds (particularly hydrogen sulfide) and the amount of urea, the major precursor of the carcinogen ethyl carbamate (10-13).

The volatiles identified in wines are usually domina-ted by fermentation products. Organic acids, higher alcohols, and esters are the main group of flavor com-pounds coming from yeast metabolism (12). Higher alcohols can be produced either by the catabolic conversion of the branched-chain amino acids (via Ehrlich) or by the anabolic formation of these amino acids de novo from a sugar substrate (14). An excess of higher alcohols (above 400 mg L-1) can be regarded as a negative influence on the quality of wine, but at the concentrations generally found in wines (below 300 mg L-1), they usually contribute to the desirable com-plexity of wine. Furthermore, these alcohols, together with the acids in wine, are substrates for ester forma-tion. Most esters, with the exception of ethyl acetate, impart a pleasant smell of fruits and flower notes in the wine (15).

J. Agric. Food Chem. 2005, 53, 996-1002

Text

os a

soci

ados

41


As mentioned, in winemaking, most of the nitrogen additions are made empirically and do not take into account the different nitrogen needs of the cell du-ring wine fermentation, the proper timing of these additions, or the nitrogen source added. In this stu-dy, we supplemented nitrogen-deficient fermenta-tions with a mixture of ammonium and amino acids at different stages of the alcoholic fermentation. We then studied the effect of these additions on the fer-mentation kinetics, the consumption of organic and inorganic nitrogen throughout the fermentation, and the influence of this consumption on the organolep-tic profile of the wines. We also monitored the effect of the nitrogen supplementations on the NCR system and the effect of the nitrogen-repressed situation on nitrogen uptake.

MATERIALS AND METHODS

Strain, Fermentations, and Sampling. A commer-cial Saccharomyces cereVisiae Var. bayanus wine strain QA23 (Lallemand S. A., Toulouse, France) was used in this study. Fermentations were carried out in a synthe-tic grape must (pH 3.3) as described by Riou et al. (16) but with 200 g L-1 of reducing sugars (100 g L-1 Glucose and 100 g L-1 Fructose) and without anaerobic factors. Only the nitrogen content changed in the different fermentations.

The yeast assimilable nitrogen (YAN) content in the control synthetic grape must was 300 mg N L-1, am-moniacal nitrogen (NH4Cl) 120 mg N L-1, and amino acids 180 mg N L-1 (Table 2). This medium also con-tained 426 mg L-1 of Proline, but it should not be con-sidered as assimilable nitrogen (17). The proportions of the different amino acids and ammonium were maintained in all the fermentations. Nitrogenlimited fermentations were carried out with 60 mg L-1 of YAN (24 mg L-1 of ammoniacal nitrogen and 36 mg L-1 of amino acid nitrogen), and 240 mg L-1 of YAN nitrogen was added at different fermentation points (96 mg L-1 of ammoniacal nitrogen and 144 mg L-1 of amino acid nitrogen).

The supplementation points were chosen by monito-ring the decrease in density of the media. Density was measured throughout the fermentation by weighing 5 mL, and nitrogen was added when the density of the must was 1060 g L-1 (30 h after inoculation), 1040 g L-1 (72 h), 1020 g L-1 (144 h), and 1000 g L-1 (240 h). Fer-mentations took place at room temperature (22-28 °C) in laboratory-scale fermenters: 2 L bottles filled with 1.8 L of medium and fitted with closures that enabled the carbon dioxide to escape and the samples to be removed. Fermentations were in semi-anaerobic con-ditions since limited aeration was necessary in order to harvest samples for the subsequent analysis. The population inoculated in every flask was 2 106 cell mL-1 from dry yeast rehydrated in water at 37 °C.

In the latter stages of the fermentation, the sugar consumption was assayed by enzymatic kits (Roche Applied Science, Germany). Fermentation was consi-dered to be complete when the residual sugars were below 2 g L-1. Cell growth was determined by absor-bance at 600 nm. Absorbance values were corrected for the initial absorbance reading obtained for juice.

Cells were harvested at different points during the fermentation so that mRNA could be analyzed. Flasks were magnetically stirred to resuspend settled bio-mass, transferred to centrifuge tubes, and centrifuged at 5000 rpm for 5 min at room temperature to prevent temperature shock. Cell pellets were transferred to 1.5 mL Eppendorf tubes and frozen immediately in liquid nitrogen. They were kept at -80 °C until they were analyzed. The supernatant of these samples was sto-red at -20 °C for extracellular metabolites and nitrogen content analysis.

Nitrogen Content Analysis. YAN was analyzed by the formol index method (18), and the ammonium content was quantified using an enzymatic method (Roche Applied Science, Germany). The individual amino and imino acids were analyzed by OPA and FMOC derivatizations, respectively, using the Agilent 1100 Series HPLC equipped with a low-pressure gra-dient quaternary pump, a thermostated autosampler, a DAD ultraviolet detector, and a fluorescence detec-tor (Agilent Technologies, Germany). The sample (2 íL) was injected into a 4.6 mm 250 mm 5 ím Hypersil ODS column (Agilent Technologies, Germany). The gradient solvent system was: solvent A (16 mM so-dium acetate and 0.022% triethylamine, adjusted to pH 7.2 with 1-2% acetic acid, and 0.6% tetrahydrofu-ran) from 100% at t ) 0 to 0% at t ) 18 min, and sol-vent B (20% of 66 mM sodium acetate, adjusted to pH 7.2 with 1-2% acetic acid, 40% acetonitrile and 40% methanol) from 0% at t ) 0 to 100% at t ) 18 min. The analysis temperature was 40 °C, and the flow rate was 1.5 mL min-1. Several dilutions of each sample were analyzed and averaged using the analysis software. The concentration of each amino acid was calculated using external and internal standards and expressed as mg L-1. The software used was Agilent ChemStation Plus (Agilent Technologies, Germany).

Ethanol, Glycerol, and Organic Acid Analysis. Etha-nol, glycerol, and organic acids were analyzed in all the samples at the end of the fermentation process. Analytical HPLC was carried out on a Hewlett- Packard HP 1050 connected to a Hewlett-Packard Integrator 3395 equipped with an HP 1047 RI detector (Agilent Technologies, Wilmington, DE) (19). The wine sample (450 íL) was mixed with 50 íL of formic acid (internal standard), and 25 íL was injected into a 300 mm 7.8 mm AMINEX HPX-87H column (BioRad, Hercules, CA).

The solvent used was sulfuric acid 2.5 mM at 0.5 mL min-1. The analysis temperature was 60 °C. The con-

42

Seminario Técnico


centration of each metabolite was calculated using external and internal standards.

Fatty Acid Analysis. Fatty acids were extracted using the method published by Lo´pez et al. (20). Analytical GC was carried out on a Hewlett-Packard 6890N con-nected to a computer with the ChemStation software (Agilent Technologies, Wilmington, DE). The extract (2 íL) was injected (splitless, 0.75 min) into a Tracer TR column of 60 m 250 ím and 0.25 ím phase thickness with an HP automatic injector (Agilent). The tempe-rature program was 40 °C for 5 min followed by 2 °C min-1 to 240 °C (15 min). Injector and detector tempe-ratures were 220 and 240 °C, respectively. The carrier gas was hydrogen at 60 mL min-1. 2-Ethylphenol (0.2 mg L-1) was added as internal standard. Internal pat-terns were used to estimate the quantity of the diffe-rent compounds.

Analysis of Higher Alcohols and Esters. Higher alcohols and esters were extracted by liquid/liquid extraction (wine 10 mL, 200 íL 1,1,2- trichlorotrifluo-roethane, 0.5 g NaCl), with n-decanol (0.2 mg L-1) as internal standard (21). After agitation for 2 min and centrifugation, the organic phase was extracted and 2 íL was injected. The chromatographic program used is the same as that used for the fatty acid analysis.

Quantification was conducted by comparison with known quantities of different products in a hydro al-coholic solution.

RNA Extraction and cDNA Synthesis. Total RNA was isolated from yeast samples as described by Sierkstra et al. (22) and resuspended in 50 íL of DEPC-treated water. Total RNA suspensions were purified using the High Pure Isolation kit (Roche Applied Science, Ger-many) following the protocol provided by the manu-facturer. RNA concentrations were determined using a GenQuant spectrophotometer (Pharmacia, Canada), and the quality of RNA was verified electrophoretically on 0.8% agarose gels. Solutions and equipment were treated so that they were RNase free, as outlined in Sambrook et al. (23).

Total RNA was reverse-transcripted with Superscript II RNase Hreverse transcriptase (Invitrogen, Carlsbad, CA) in a GenAmp PCR System 2700 (Applied Biosys-tems, Foster City, CA). Oligo (dT)12-18 primer ( 0.5 íg, Invitrogen) was used with 0.8 íg of total RNA as tem-plate in a reaction volume of 20 íL. Following the pro-tocol provided by the manufacturer, after denatura-tion at 70 °C for 10 min, cDNA was synthesized at 42 °C for 50 min. Finally, the reaction was inactivated at 70 °C for 15 min.

Real-Time Quantitative PCR. The PCR primers used in this study are ACT-F, TGGATTCCGGTGATGGTGTT, and ACT-R, CGGCCAAATCGATTCTCAA (ACT, for acti-ne gene); GAP1-F, CTGTGGATGCTGCTGCTTCA, and

GAP1-R, CAACACTTGGCAAACCCTTGA (GAP1, for ge-neral amino acid permease gene); and MEP2- F, GG-TATCATCGCTGGCCTAGTG, and MEP2-R, ACAACGGCT-GACCAGATTGG (MEP2, for ammonium permease gene) (9).They were all designed with the available GenBank sequence data and the Primer Express soft-ware (Applied Biosystems) in accordance with the Applied Biosystems guidelines for designing PCR pri-mers for quantitative PCR. All amplicons were short, which ensured maximal PCR efficiency and, therefore, the most precise quantification.

For each gene, a standard curve was made with yeast genomic DNA. DNA extraction was performed as des-cribed by Querol et al. (24), digested by RNase, and isolated by 2-fold phenol-chloroform extractions and ethanol precipitation. Concentration was determined using a GeneQuant spectrophotometer (Pharmacia, Canada). Serial 10-fold dilutions of DNA were carried out to yield DNA concentrations from 4 to 4 10-5 ng íL-1. These dilution series were amplified (in duplicate) by SYBR PCR for each gene to obtain standard curves (see above). The standard curve displays the Ct value vs log10 of each standard’s starting quantity. The star-ting quantity of the unknown samples was calculated against the standard curve by interpolation, and gene expression levels are shown as the concentration of the studied gene normalized with the concentration of the housekeeping ACT gene.

The real-time quantitative PCR reaction was perfor-med using SYBR Green I PCR (Applied Biosystems). In SYBR PCR, amplification is monitored by the gain in fluorescence of the double-strand-specific DNA-binding dye SYBR green. The 25 íL SYBR PCR reactions contained 300 nM of each PCR primer, together with 1 íL cDNA (or 5 íL of each DNA serial dilution for stan-dard tubes) and one time SYBR master mix (Applied Biosystems).

All PCR reactions were mixed in 96-well optical pla-tes (Applied Biosystems) and cycled in a PE Applied Biosystems 5700 thermal cycler under the following conditions: 50°C for 2 min, 95°C for 10 min, and 40 cy-cles at 95°C for 15 s and at 60 °C for 60 s.

The PE5700 cycler provided cycle-by-cycle measu-rement of the fluorescence emission from each PCR reaction. Analysis resulted in the assignation of a threshold cycle (Ct) value to each PCR reaction.

The Ct value is the cycle number at which an increase in reporter fluorescence above a baseline signal can first be detected. The threshold was positioned to in-tersect the exponential part of the amplification cur-ve of positive reactions, as recommended by Applied Biosystems.

The Ct value is inversely proportional to the log of the amount of template in the PCR reaction; the lower the

Text

os a

soci

ados

43


Ct value, the higher the concentration of template in the PCR reaction. Assuming a 100% effective PCR am-plification, a difference of one Ct value corresponds to a 21 ) 2-fold difference in the amount of template. All samples were analyzed in duplicate, and the expres-sion values were averaged by the analysis software (Applied Biosystems). The coefficient of variation in all samples analyzed was less than 10%.

RESULTS

Effect of Nitrogen Addition on Fermentation Kine-tics and Nitrogen Consumption. Five fermentations started with a nitrogen content of 60 mg L-1, which is low enough for a fermentation to be sluggish but high enough for it to finish.

Four of these nitrogen-deficient fermentations were supplemented at different points with 240 mg L-1 of YAN; the first one at a density of 1060 g L-1, and the second, third, and fourth at 1040, 1020, and 1000 g L-1, respectively. The remaining fermentation was not supplemented, but subjected to nitrogen deficiency throughout the process. As a fermentation control, we used the same medium with a nondeficient amount of nitrogen (300 mgN L-1) (9).

Figure 1 shows the effect of nitrogen additions on O. D. measures throughout the fermentations studied. The nitrogendeficient fermentations had lower O. D. values than the control fermentation. When nitro-gen was added in the first half of the fermentations (density of 1060 and 1040), these effects were almost overcome, and the O. D. values were similar to those of the control fermentation. Additions at densities of 1020 and 1000, however, had minimal effects on O. D. measures.

Table 1 summarizes the evolution of the fermentation and nitrogen consumption, measured as ammonium

and amino acid nitrogen. Unlike their effect on the O. D. values, the nitrogen additions clearly stimulated the fermentation regardless of when they were made. In the nitrogen-deficient fermentation, yeast consumed the total YAN after the first day (data not shown).

However, nitrogen was not completely consumed in the control fermentation. The nitrogen additions were all carried out when the initial YAN had already been depleted, and the later the nitrogen was added, the lower the amount of YAN was consumed (Table 2). The ammonium consumed was 54% of the total YAN consumed in the control fermentation (Table 2), but this proportion decreased when nitrogen was added later in the fermentation. Ammonium was proportio-nally preferred as the nitrogen source when the addi-tions were made in the first half of the fermentations (N1060 and N1040). In later additions (N1020 and N1000), the small amount of nitrogen consumed was mostly from amino acids.

The consumption of amino acids was monitored at different points during the fermentations. The yeast’s pattern of amino acid utilization changes with the time of YAN supplementation (Table 2). The amino

Table 1. Determination of Yeast Assimilable Nitrogen (YAN) in the Fermentation Media, Represented by the Amino Acid Fraction (YAN aas) and bythe Ammonium fraction (YAN NH4+)

control fermentation N addition at F) 1060 N addition at ρ = 1040density

(ρ)time(h)

YAN NH4+

(mg N L- 1)YAN aas

(mg N L- 1)time(h)

YAN NH4+

(mg N L- 1)YAN aas

(mg N L- 1)time(h)

YAN NH42+

(mg N L- 1)YAN aas

(mg N L- 1)1080 0 120 168 0 25 41 0 25 401060 30 70 98 36 0.5 (90a) 4 (145a) 36 0.1 41040 56 52 95 62 50 105 78 0.1 (92a) 4 (136a)1020 96 36 98 96 45 104 120 68 1041000 168 35 98 168 42 108 192 65 110990 (endb) 312 41 102 312 50 110 336 66 114

N addition at ρ =1020 N addition at ρ = 1000 no N additiondensity

(ρ)time(h)

YAN NH4+

(mg N L- 1)YAN aas

(mg N L- 1)time(h)

YAN NH4+

(mg N L- 1)YAN aas

(mg N L- 1)time(h)

YAN NH4+

(mg N L- 1)YAN aas

(mg N L- 1)1080 0 25 41 0 26 40 0 26 401060 36 0 7 36 0 7 36 0 51040 78 0 7 78 0 4 78 0 21020 150 0 (92a) 4 (143a) 150 0 4 150 0 11000 240 81 109 264 0 (99a) 2 (147a) 264 1 1990 (endb) 408 88 118 456 100 130 504 1 1

Figure 1. Effect of nitrogen additions on O. D. measures (λ = 600 nm) throughout synthetic grape must fermentations. The arrows indicate the time

of addition.

a NH4+ and aas YAN content just after the nitrogen addition. b End of fermentation.

44

Seminario Técnico


Table 2. Total Consumption of Amino Acids and Ammonia at the End of Each Fermentation Expressed as mg N L-1a

acids can be grouped in different sets according to the preference of the cell in the different conditions.

The amino acids that are most consumed are glutami-ne and tryptophan. Together they represented 32% of the total assimilable amino acids of the synthetic gra-pe must (Table 2), and regardless of the fermentation conditions, their consumption accounted for 50% to 65% of the total amino acids consumed.

On the other hand, the consumption of arginine, glu-tamate, glycine, alanine, and aspartate, which were approximately 44% of the total assimilable amino acids in the medium (Table 2), was together hardly 2% of the total amino acids consumed in the control fermentation. The consumption of these amino acids was much higher in the fermentations supplemented with nitrogen. However, yeast cells only consumed these amino acids before the nitrogen addition: that is, when the fermentations were nitrogen-deficient. Last, there is one other set of amino acids, consisting of threonine, histidine, leucine, isoleucine, phenylala-nine, valine, and methionine, which was consumed proportionally more in the control fermentation than in the supplemented fermentations.

GAP1 and MEP2 Gene Expression. The expression of the nitrogen transporters GAP1 and MEP2 was analy-zed and quantified relative to the expression of the housekeeping actine gene. Time zero was the expres-sion of yeast before inoculation (and after rehydra-tion). Both genes were repressed in the first hours after inoculation in the must-like medium (Figure 2). In the nitrogen-deficient fermentation, these genes started to be activated/de-repressed after 30 h, when nitrogen was almost depleted. The expression of both genes increased continuously during the first days of fermentation and peaked after 4 and 6 days for GAP1

and MEP2, respectively. The expression of the genes decreased in the last days of fermentation, after seve-ral days without a nitrogen source. On the other hand, the presence of residual nitrogen in the control fer-mentation repressed these genes throughout.

a In the fermentations with nitrogen additions, post-add represents the nitrogen taken up after this addition.

controlconsumption

N1060consumption

N1040consumption

N1020consumption

N1000consumption

no Nconsumptionamino

acids

full Nmedia

content total total post-add total post-add total post-add total post-add totalGln 47.4 25.5 34.9 22.1 24.5 11.8 29.0 16.2 23.1 10.3 12.8Trp 10.3 6.6 6.8 4.2 7.7 4.1 8.1 4.5 7.8 4.1 3.6Thr 9.9 9.4 3.6 1.4 2.6 0.7 2.0 0.2 1.9 0.1 1.8His 3.8 3.7 1.5 1.5 1.2 1.2 0.8 0.8 0.4 0.4 −Leu 4.7 4.2 2.6 1.1 1.8 0.8 1.4 0.4 1.2 0.2 1.0Ile 3.8 3.2 1.8 0.6 1.4 0.7 0.8 0.2 0.7 0.1 0.6Phe 2.8 2.4 1.2 0.4 1.3 0.5 1.2 0.4 0.9 0.1 0.8Val 5.1 3.0 1.6 0.4 1.1 0.1 1.0 − 1.1 − 1.0Ser 7.5 2.8 2.9 0.8 1.7 − 1.7 − 1.9 0.1 1.8Met 1.8 1.8 1.1 0.5 1.0 0.6 0.6 0.3 0.5 0.2 0.3Lys 1.9 1.1 0.7 − 1.0 0.9 1.0 0.9 0.1 − 0.2Arg 47.9 0.6 5.9 − 9.0 0.9 8.8 0.7 8.2 − 8.2Tyr 1.4 0.4 0.2 − 0.3 − 0.3 − 0.3 − 0.3Glu 11.8 0.5 2.3 − 2.0 − 2.7 0.2 2.5 − 2.5Gly 3.1 0.2 − − − − − − 0.3 − 0.4Ala 12.1 − 1.2 − 1.7 − 2.7 − 3.1 − 3.2Asp 4.2 − − − − − − − − − 0.1YAN aas 179.5 65.5 68.4 34.5 58.2 22.2 62.1 24.6 53.9 15.7 38.6YAN NH4+ 120.0 79.2 64.9 39.5 51.4 26.0 29.5 4.1 25.4 − 25.4

Figure 2. Gene expression of ammonium permease (MEP2) and general amino acid permease (GAP1) at time zero (before inoculation) and at different points

during the control fermentation and the nitrogen-deficient fermentation (without nitrogen addition). The data were quantified by calculating the ratio between

the concentration of the studied genes normalized with the concentration of the housekeeping ACT gene, and

expressed as a percentage (the quantity ratio 1 was set as 100%). YAN and ammonia consumption throughout

the fermentations are also indicated.

Text

os a

soci

ados

45


Figure 3 shows the gene expression of GAP1 and MEP2 in the first 24 h after the nitrogen addition. They were both repressed in all the fermentations. Howe-ver, the later the addition took place in the fermenta-tion process, the longer it took for the genes to be re-pressed. When nitrogen was added at the end of the fermentation (density 1000), the effect was negligible because of the low expression at this point.

Analytical Profile. We analyzed the residual sugars, ethanol, glycerol, and acids in the wines obtained from the different fermentations and such flavor com-pounds as higher alcohols, volatile fatty acids, and es-ters, which arose from yeast metabolism (Table 3). The later the nitrogen addition was, the lower the concen-tration of glycerol, acetic acid, and acetaldehyde was.

The higher alcohol content was lower when excess nitrogen was available at the beginning of the fer-mentation (control fermentation and N1060). These different concentrations were accounted for by the increase in isoamyl alcohol and 2-phenylethanol.

The concentration of these compounds increased considerably in the fermentations with nitrogen addi-tions in the later phases (or no addition), and were approximately 2 and 5 times higher than in the con-trol fermentation. The increase in isoamyl alcohol did not lead to a corresponding clear increase in its es-ter (isoamyl acetate) in these fermentations, and the phenyl-2-ethanol acetate ester only increased slightly. In fact, the differences in the concentration of the total acetate esters between the fermentations were due to the concentration of ethyl acetate, which was more than 95% of the total acetate esters.

Its concentration was higher in the control fermen-tation and the N1060 and 1040 fermentations, which correlated with a higher acetate concentration. The differences in the concentration of fatty acids and their esters were smaller in the final products of the fermentations.

DISCUSSION

The addition of nitrogen to grape musts, especially in the form of ammoniacal nitrogen, is a common winemaking practice that prevents nitrogen-related fermentation problems. Several studies, in which grape musts were supplemented with diammonium phosphate, have proved that nitrogen supplements can optimize fermentation performance (2-4). In the present study, we supplemented a nitrogen-deficient synthetic must with a mixture of ammonium and ami-no acids at different stages of the alcoholic fermenta-tion. Then we studied the effect of these additions on

Figure 3. Relative gene expression of GAP1 and MEP2 at different points in the first 24 h after the nitrogen addition. Time zero represents the point just before this addition. The data were calculated

as in Figure 2.

Table 3. Secondary Metabolites Produced by Yeasts during the Different Fermentationsa

a Values are the average of two determinations and the coefficient of variation in all the compounds analyzed was less than 10% with the exception of decanoic acid (18%), dodecanoic acid (38%), ethyl octanoate (16%), and ethyl decanoate (29%).

controlferm. N1060 N1040 N1020 N1000

no Naddition

Alcohols and Acids (g L 1)ethanol 98.7 97.2 98.0 98.0 98.7 101.1glycerol 6.56 6.57 6.32 6.11 5.78 6.12acetate 1.17 1.22 0.98 0.80 0.89 0.81acetaldehyde 0.33 0.28 0.26 0.25 0.24 0.22citrate 0.41 0.41 0.38 0.41 0.39 0.41succinate 0.13 0.21 0.27 0.26 0.23 0.23lactate 0.04 0.05 0.04 0.03 0.02 0.02

Higher Alcohols (mg L 1)n-propanol 37 33 28 20 13 12isobutanol 11 13 16 16 16 16isoamylic alcohol 50 48 81 97 94 94phenyl-2-ethanol 11 21 42 46 53 43

109 115 167 179 176 165Fatty Acids (mg L 1)

isobutyric acid 0.39 0.40 0.43 0.39 0.50 0.41butyric acid 0.63 0.73 0.67 0.72 0.59 0.60isovaleric acid 0.63 0.37 0.30 0.44 0.80 0.60valeric acid 0.12 0.09 0.09 0.10 0.18 0.15hexanoic acid 2.06 1.58 1.40 1.53 1.90 1.85octanoic acid 2.30 1.95 1.84 2.34 2.43 2.49decanoic acid 0.39 0.37 0.21 0.19 0.14 0.46dodecanoic acid 0.16 0.14 0.09 0.16 0.32 0.28

6.70 5.63 5.02 5.87 6.86 6.83Acetate Esters (mg L 1)

ethyl acetate 35 35 32 25 19 28isobutyl acetate 0.023 0.024 0.012 0.016 0.011 0.011isoamyl acetate 0.49 0.46 0.39 0.69 0.39 0.29hexyl acetate 0.006 0.005 − − − −phenyl-2-ethanol acetate 0.21 0.37 0.41 0.47 0.41 0.29

35.73 35.86 32.81 26.18 19.81 28.59Fatty Acid Esters (mg L 1)

ethyl butyrate 0.224 0.220 0.163 0.232 0.164 0.124ethyl isobutyrate 0.006 0.005 0.006 0.005 0.004 0.007ethyl hexanoate 0.089 0.071 0.23 0.31 0.23 0.085ethyl octanoate 0.022 0.022 0.060 0.081 0.059 0.020ethyl decanoate 0.002 0.004 0.019 0.024 0.019 0.004

0.343 0.322 0.478 0.652 0.446 0.240

46

Seminario Técnico


the fermentation kinetics, the consumption of organic and inorganic nitrogen throughout the fermentation, and the influence of this consumption on the aroma compound profile of the wines.

We observed a reduction in the fermentation length regardless of the time of addition and, consequently, a reduction in the total fermentation time. However, the fermentation length decreased even further when ni-trogen was added during the exponential phase and yeast cells probably used this nitrogen for biomass production. These results largely agree with those previously reported (2-4). However, the yeast strain QA23 used in this study seems to have low nitrogen requirements. It used only 147 mg N L-1 in the con-trol fermentation and finished it with only 60 mg N L-1. Agenbach (25) established that fermentations require a minimal amount of 140 mg N L-1 to avoid getting stuck. In fact, nitrogen demands and preferences are strain dependent (26-28) and, therefore, it should be taken into account that we only used one strain.

As in previous experimental studies (2, 6), we obser-ved that nitrogen additions during the period of cell growth resulted in an increase in cell biomass. During the cell growth phase of the fermentation, most car-bon- and nitrogen-containing compounds are di-verted to biomass production. When growth stops, however, only small amounts of these nutrients are required, primarily for cell maintenance (3).

The metabolism of nitrogen depends heavily on its uptake through the different nitrogen transporters. In this study, we monitored the activity of the genes en-coding two important permeases in the transport of amino acids (GAP1) and ammonium (MEP2) throug-hout fermentation. In a previous study (5), we obser-ved that both permeases were repressed in a nitro-gen-rich medium by the mechanism called nitrogen catabolite repression (NCR). The present study con-firms this repression because in the control fermen-tation their expressions were almost negligible and in the limiting nitrogen condition their expressions dropped sharply at the beginning, when nitrogen was still available, and increased continuously when it was not. The NCR of both transporters was fast and effec-tive, as seen with the nitrogen additions, although the cell response to the excess of nitrogen in the medium was quicker when the nitrogen addition was in the first half of fermentation. During the last stages of fer-mentation, ethanol content is high and it is well esta-blished that the first target of ethanol toxicity is the plasma membrane (29, 30), which can be impaired for a long period of anaerobic growth. Therefore, the sen-sing system of the cell, mainly located in the plasma membrane, may be affected by both effects (31).

The moment of the fermentation process at which the NCR was established (by the nitrogen addition) determined the pattern of amino acid consumption.

As previously reported (9), arginine, alanine, aspartate, glutamate, and glycine were the amino acids that were most affected by the NCR because they were hardly consumed when there was an excess of nitrogen. In fact, they were not taken up until the medium was de-pleted of good nitrogen sources. These amino acids must be transported mainly by the general amino acid permease (Gap1p) or by other specific permeases also subjected to NCR. A similar uptake pattern for these amino acids was previously reported in both synthetic and natural grape juices (1, 26). On the other hand, in brewing conditions (32) arginine and glutamine were rapidly consumed whereas ammonium uptake was delayed. Branched-chain and aromatic amino acids behaved in a completely different way.

Except for tryptophan, they were mostly consumed in the first stages of the control fermentation: that is, when the cells were subjected to NCR from the be-ginning of the fermentation process. A common fea-ture of the genes that encode the permeases of the branched-chain amino acids (BAP1 and BAP2) and aromatic amino acids (TAT1 and TAT2) is that they are induced in a nitrogen-rich medium (33, 34).

Regardless of the time of addition, glutamine and tryptophan were the main amino acids consumed af-ter the nitrogen additions, and therefore, they may be very important for the yeast cell metabolism throug-hout the process.

Ammonium accounted for 40% of the total YAN of the fermentation media. However, its consumption depended on the timing of the addition. Ammonium is the preferred nitrogen source for biomass produc-tion but was hardly consumed when it was added in the final stages of the fermentation. These differences in ammonium uptake are difficult to explain in terms of permease regulation. In the present study and in our previous one (9), we detected that, the more ni-trogen there was in the fermentation media, the more repressed the three MEP genes were. Marini et al. (35) have proposed two possible hypotheses to explain this paradox: either the yeast possesses additional ammonium transport systems unrelated to the Mep proteins, or highly concentrated ammonium is taken up into the cells by simple diffusion.

The timing of the nitrogen additions directly deter-mined the likely aroma characteristics of the wines. Glycerol increased in the fermentations with higher biomass production and higher ammonium con-sumption. The relationship between biomass forma-tion and glycerol synthesis has already been reported (36- 38). Likewise, a higher glycerol yield was also ob-served on a synthetic glucose-rich medium when am-monium was used as the sole nitrogen source instead of a mixture of ammonium and amino acids (39). Mi-chnick et al. (40) also related the production of glyce-rol to the accumulation of acetate and acetaldehyde.

Text

os a

soci

ados

47


Higher alcohols were also affected by the changes in nitrogen utilization. These compounds can be produ-ced either by the catabolic conversion of the bran-ched-chain amino acids (via Ehrlich) or by the ana-bolic formation of these amino acids de novo from a sugar substrate (14, 15). Our results show that the anabolic route is of greater importance because the increase in isoamyl alcohol and 2-phenyl ethanol was inversely proportional to the consumption of leucine and phenylalanine, respectively.

Furthermore, the closer the nitrogen concentration is to the growth-limiting level, the higher the yield of fusel alcohols is.

There is also an inverse correlation between ammo-nium consumption and the production of fusel alco-hols (12). A greater concentration of higher alcohols did not seem to determine an increase in esters. In contrast, the acetate concentration seemed to deter-mine a greater concentration of acetate esters, espe-cially ethyl acetate.

In conclusion, our study shows the quantity and qua-lity of the nitrogen demands of the wine strain QA23. Although further studies should be carried out with other wine strains, our data show that cell growth and fermentation have different preferred nitrogen sources. Nitrogen additions always improved fermen-tation performance but had a minimal effect on bio-mass production when added in the second half of the fermentation. These nitrogen additions subjected the cells to NCR and changed the profile of nitrogen consumption. The differences in the pattern of nitro-gen consumption were related to different aroma compound compositions in the wines. In our opinion, this study is a starting point for further investigation into using an ammonium/amino acid mixture as ni-trogen supplementation in the wine industry and the effect that these additions have on yeast physiology, fermentation performance, and wine quality.

ACKNOWLEDGMENT

This work was supported by grant AGL2000-0205-P4-03 from the Comisión Interministerial de Ciencia y Tecnología, Spain.

The authors wish to thank the language service of the Rovira i Virgili University for revising the manuscript.

LITERATURE CITED

(1) Bisson, L. F. Influence of nitrogen on yeast and fer-mentation of grapes. In Proceedings of the Inter-national Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enolo-gy and Viticology: Davis, CA, 1991.

(2) Bely, M.; Sablayrolles, J. M.; Barre, P. Automatic de-tection of assimilable nitrogen deficiencies du-ring alcoholic fermentation in oenological con-ditions. J. Ferment. Bioeng. 1990, 70, 246- 252.

(3) Jiranek, V.; Langridge, P.; Henschke, P. A. Yeast nitro-gen demand: selection criterion for wine yeasts for fermenting low nitrogen musts. In Procee-dings of the International Symposium on Nitro-gen in Grapes and Wine; Ranz, J. M., Ed.; Ameri-can Society of Enology and Viticology: Davis, CA, 1991. (4) Monteiro, F. F.; Bisson, L. F. Nitrogen su-pplementation of grape juice. I. Effect on amino acid utilization during fermentation. Am. J. Enol. Vitic. 1992, 43, 1-10.

(5) Bely, M.; Sablayrolles, J. M.; Barre, P. Description of alcoholic fermentation kinetics: its variability and significance. Am. J. Enol. Vitic. 1990, 41, 319-324.

(6) Mendes-Ferreira, A.; Mendes-Faia, A.; Leao, C. Growth and fermentation patterns of Saccha-romyces cereVisiae under different ammonium concentrations and its implications in winema-king industry. J. Appl. Microbiol. 2004, 97, 540-545.

(7) Cooper, T. G. Nitrogen metabolism in Saccharomy-ces cereVisiae. In The molecular Biology of the Yeast Saccharomyces; Stratherm, J. N., Jones, E. W., Broach, J. R., Eds.; Cold Spring Harbor Labora-tory: Cold Spring Harbor, New York, 1982.

(8) ter Schure, E. G.; van Riel, N. A.; Verrips, C. T. The role of ammonia metabolism in nitrogen catabolite repression in Saccharomyces cereVisiae. FEMS Microbiol. ReV. 2000, 24, 67- 83.

(9) Beltran, G.; Novo, M.; Rozes, N.; Mas, A.; Guillamon, J. M. Nitrogen catabolite repression in Saccha-romyces cereVisiae during wine fermentations. FEMS Yeast Res. 2004, 4, 625-632.

(10) Jiranek, V.; Langridge, P.; Henschke, P. A. Regulation of hydrogen sulfide liberation in wine-producing Saccharomyces cereVisiae strains by assimilable nitrogen. Appl. EnViron. Microbiol. 1995, 61, 461-467.

48

Seminario Técnico


(11) Ough, C. S. Influence of nitrogen compounds in grapes in ethyl carbamate formation in wines. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Da-vis, CA, 1991.

(12) Rapp, A.; Versini, G. Influence of nitrogen com-pounds in grapes on aroma compounds of wi-nes. In Proceedings of the International Sympo-sium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA, 1991.

(13) Marks, V. D.; van der Merwe, G. K.; van Vuuren, H. J. Transcriptional profiling of wine yeast in fer-menting grape juice: regulatory effect of dia-mmonium phosphate. FEMS Yeast Res. 2003, 3, 269-287.

(14) Äyräpää, T. Biosynthetic formation of higher alco-hols by yeast. Dependence on the nitrogenous nutrient level of the medium. J. Inst. Brew. 1971, 77, 276.

(15) Lambrechts, M. G.; Pretorius, I. S. Yeast and its im-portance to wine aroma. S. Afr. J. Enol. Vitic 2000, 21, 97-129.

(16) Riou, C.; Nicaud, J. M.; Barre, P.; Gaillardin, C. Sta-tionaryphase gene expression in Saccharomyces cereVisiae during wine fermentation. Yeast 1997, 13, 903-915.

(17) Salmon, J. M.; Barre, P. Improvement of nitrogen assimilation and fermentation kinetics under enological conditions by derepression of alter-native nitrogen-assimilatory pathways in an in-dustrial Saccharomyces cereVisiae strain. Appl. EnViron. Microbiol. 1998, 64, 3831-3837.

(18) Aerny, J. Compose´s azote´s des mouˆts et vins. ReV. Suisse Vitic. Arboric. Hortic. 1996, 28, 161-

165.

(19) Torija, M. J.; Beltran, G.; Novo, M.; Poblet, M.; Rozes, N.; Mas, A.; Guillamon, J. M. Effect of organic acids and nitrogen source on alcoholic fermentation: study of their buffering capacity. J. Agric. Food Chem. 2003, 51, 916-922.

(20) Lopez, R.; Aznar, M.; Cacho, J.; Ferreira, V. Determi-nation of minor and trace volatile compounds in wine by solid-phase extraction and gas chroma-tography with mass spectrometric detection. J. Chromatogr. A 2002, 966, 167-177.

(21) Ferreira, V.; Sharman, M.; Cacho, J.; Dennis, J. New and efficient microextraction/solid-phase extrac-tion method for the gas chromatographic analy-sis of wine volatiles. J. Chromatogr. A 1996, 731, 247-259.

(22) Sierkstra, L. N.; Verbakel, J. M.; Verrips, C. T. Analy-sis of transcription and translation of glycolytic enzymes in glucoselimited continuous cultures of Saccharomyces cereVisiae. J. Gen. Microbiol. 1992, 138, 2559-2566.

(23) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Methods in Yeast Genetics: A Laboratory Manual, 2 ed.; Cold Spring Harbor Laboratory: Cold Spring Harbor, New York, 1989.

(24) Querol, A.; Barrio, E.; Ramon, D. A comparative stu-dy of different methods of yeast strain characteri-zation. Syst. Appl. Microbiol. 1992, 21, 315-323.

(25) Agenbach, W. A. A study of must nitrogen content in relation to incomplete fermentations, yeast production and fermentation. Proc. South Afr. Soc. Enol. Vitic. 1977, 87.

(26) Jiranek, V.; Langridge, P.; Henschke, P. A. Amino acid and ammonium utilization by Saccharomy-ces cereVisiae wine yeasts from a chemical defi-ned medium. Am. J. Enol. Vitic. 1995, 46, 75-83.

(27) Manginot, C.; Roustan, J. L.; Sablayrolles, J. M. Ni-trogen demand of different yeast strains during alcoholic fermentation. Importance of the statio-nary phase. Enzyme Microb. Technol. 1998, 23, 511-517.

(28) Ough, C. S.; Huang, D. A.; Stevens, D. Amino acid uptake by four commercial yeasts at two diffe-rent temperatures of growth and fermentation: Effects on urea excretion and readsorption. Am. J. Enol. Vitic. 1991, 41, 26-40.

(29) Alexandre, H.; Rousseaux, I.; Charpentier, C. Rela-tionship between ethanol tolerance, lipid com-position and plasma membrane fluidity in Sac-charomyces cereVisiae and Kloeckera apiculata. FEMS Microbiol. Lett. 1994, 124, 17-22.

(30) Alexandre, H.; Rousseaux, I.; Charpentier, C. Etha-nol adaptation mechanisms in Saccharomyces cereVisiae. Biotechnol. Appl. Biochem. 1994, 20, 173-183.

(31) Gagiano, M.; Bauer, F. F.; Pretorius, I. S. The sensing of nutritional status and the relationship to fila-mentous growth in Saccharomyces cereVisiae. FEMS Yeast Res. 2002, 2, 433-470.

Text

os a

soci

ados

49


(32) Pierce, J. S. The Margaret Jones Memorial Lecture: Amino acids in malting and brewing. J. Inst. Brew. 1982, 88, 228-233.

(33) Forsberg, H.; Ljungdahl, P. O. Sensors of extrace-llular nutrients in Saccharomyces cereVisiae. Curr. Genet. 2001, 40, 91-109.

(34) Regenberg, B.; During-Olsen, L.; Kielland-Brandt, M. C.; Holmberg, S. Substrate specificity and gene expression of the amino acid permeases in Sa-ccharomyces cereVisiae. Curr. Genet. 1999, 36, 317-328.

(35) Marini, A. M.; Soussi-Boudekou, S.; Vissers, S.; An-dre, B. A family of ammonium transporters in Sa-ccharomyces cereVisiae. Mol. Cell Biol. 1997, 17, 4282-4293.

(36) Bakker, B. M.; Overkamp, K. M.; van Maris, A. J.; Kotter, P.; Luttik, M. A.; van Dijken, J. P.; Pronk, J. T. Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cereVisiae. FEMS Microbiol. ReV. 2001, 25, 15-37.

(37) Radler, F.; Schu¨tz, H. Glycerol production of va-rious strains of Saccharomyces. Am. J. Enol. Vitic. 1982, 33, 36-40.

(38) Watanabe, M.; Uehara, M.; Shinohara, T. Effect of cell number on the formation of glycerol and some volatile components by yeast. J. Brew. Soc. Jpn. 1982, 77, 346.

(39) Albers, E.; Larsson, C.; Liden, G.; Niklasson, C.; Gus-tafsson, L. Influence of the nitrogen source on Saccharomyces cereVisiae anaerobic growth and product formation. Appl. EnViron. Microbiol. 1996, 62, 3187-3195.

(40) Michnick, S.; Roustan, J. L.; Remize, F.; Barre, P.; De-quin, S. Modulation of glycerol and ethanol yields during alcoholic fermentation in Saccharomyces cereVisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3-phosphate dehydro-genase. Yeast 1997, 13, 783-793.

Received for review August 2, 2004. Revised manuscript received November 12, 2004. Accepted November 17, 2004.

50

Seminario Técnico


Formación de compuestos volátiles azufrados por levaduras vinicas.Swigers, J. H.; Pretorius, I.S.

Australian Wine Research Institute AWRI.

El artículo íntegramente reproducido a continuación se publico on line en Applied Microbiol Biotechnol en Enero de 2007.

Resumen

Los compuestos de azufre en el vino constituyen una espada de doble filo. Por una parte, ciertos com-puestos volátiles que contienen azufre como el sulfu-ro de hidrógeno ofrecen un aroma similar a huevos podridos, por lo que pueden afectar negativamente a la calidad sensorial del vino pero, por otra parte, algunos compuestos de azufre como el 3-mercap-tohexanol, que proporciona notas afrutadas, puede tener un impacto positivo sobre el sabor y el aroma del vino. Además, estos compuestos se pueden volver más o menos atractivos o repulsivos dependiendo de sus concentraciones absolutas y relativas. Por consi-guiente es un desafío interesante que los vinicultores modulen las concentraciones de tales compuestos determinantes de la calidad del vino según las pre-ferencias de los consumidores. La levadura del vino, Saccharomyces cerevisiae, desempeña un papel clave en la producción de compuestos volátiles de azufre. A través de la ruta de la secuencia de reducción del sulfato se forma HS-, el cual puede conducir a la for-mación de sulfuro de hidrógeno y diversos mercap-tanos. Por tanto, limitar la formación del ión HS es un objetivo importante en la ingeniería metabólica de esta levadura. La levadura del vino también es respon-sable de la transformación de precursores de azufre no volátiles presentes en la uva, en tioles volátiles con propiedades aromatizantes. En particular, 4-mercap-to-4-metilpentan-2-ona, 3-mercaptohexanol y ace-tato de 3-mercaptohexilo son los tioles volátiles más importantes que añaden aromas afrutados al vino. El presente documento revisa brevemente el proceso metabólico implicado en la producción de importan-tes compuestos volátiles de azufre y las principales estrategias a la hora de conseguir desarrollar cepas de levaduras como herramienta para ajustar el aroma del vino a las especificaciones del mercado.

Palabras clave: Aroma . Sabor . Bebidas fermenta-das . Tioles . Vino . Levadura

1- Introducción

El azufre es un elemento abundante en la naturaleza y presente en muchos compuestos. Puede presentarse en forma oxidada (sulfato) o reducida (sulfuro). El azu-fre es uno de los elementos más importantes necesa-rios para la vida, particularmente como componente de los aminoácidos cisteína y metionina, y también es un componente de cofactores esenciales. Los micro-organismos pueden metabolizar los compuestos de azufre a través de dos rutas. En la ruta de reducción asimilativa del azufre se toma sulfato y se utiliza para la biosíntesis de compuestos orgánicos como la cisteína y la metionina. En la ruta de reducción disimilativa del sulfato, la molécula de sulfato se reduce como parte de una ruta respiratoria a sulfito o sulfuro. Ninguno de estos metabolitos se vuelve a metabolizar y la mayoría se excreta (Kappler y Dahl 2001). La ruta anterior es realizada por bacterias reductoras de sulfato que están ampliamente distribuidas en ambientes anaeróbicos como el suelo, los sedimentos, agua de mar y agua dulce y en la boca e intestino de muchos animales (Purdy et al. 2002). Los microorganismos también son capaces de descomponer los aminoácidos con azufre cisteína y metionina para formar sulfuros y posterior-mente otros compuestos volátiles de azufre y tioles (Dainty et al. 1989; Russell et al. 1995; Bonnarme et al. 2000; Seefeldt y Weimer 2000; Morales et al. 2005).

La levadura de vino Saccharomyces cerevisiae es responsable de la producción de varios compuestos volátiles de azufre que afectan a la calidad sensorial del vino. Estos importantes compuestos volátiles de azufre son: (1) sulfuro de hidrógeno (aroma a huevos podridos); (2) metanotiol (metilmercaptano; aroma a col cocida); (3) dimetilsulfuro, dimetildisulfuro y dime-tiltrisulfuro (aromas a col, coliflor y ajo); (4) metiltioes-teres (tioacetato de S-metilo, tiopropanato de S-meti-lo y tiobutanato de S-metilo; aromas a coliflor cocida, queso y cebolleta); y (5) los “tioles volátiles afrutados” del vino (aromas a maracuyá, pomelo, grosella espi-nosa, guayaba y aromas a boje; Swiegers y Pretorius 2005; Swiegers et al. 2006). Durante la fermentación del vino, la reducción asimilativa de sulfato por la le-vadura (para biosintetizar cisteína y metionina) puede producir un exceso de iones HS-, lo que genera la for-mación H

2S en el vino (Jiranek et al. 1995; Spiropoulos

et al. 2000; Mendes- Ferreira et al. 2002; Swiegers et al. 2005a). Esto es probablemente uno de los problemas más comunes en una bodega y, si no se trata, el vino resultante estará contaminado provocando una pér-dida de calidad y la posibilidad de que sea rechazado por los consumidores (Vos y Gray 1979; Henschke y Ji-ranek 1991; Rauhut 1993). Los vinos fermentados fina-lizados a menudo se tratan con sulfato de cobre con el fin de que reaccione con los compuestos de azufre para formar complejos estables y, por tanto, eliminar los efectos negativos del H

2S y de los mercaptanos.

No obstante no es deseable utilizar sulfato de cobre en el vino. La concentración de H

S producido durante

Applied Microbiol Biotechnol, Enero de 2007 (on line)

Text

os a

soci

ados

51

Formación de compuestos volátiles azufrados por levaduras vinicas

la fermentación del vino depende de varios factores como la presencia de compuestos de azufre, la cepa de la levadura, las condiciones de fermentación y los nutrientes del zumo de uva (Henschke y Jiranek 1991; Rauhut 1993; Spiropoulos et al. 2000). No obstante, algunas cepas parecen producir H

2S intrínsecamen-

te sin que les afecten las condiciones ambientales, lo que posiblemente indica un defecto metabólico (Jiranek et al. 1995; Spiropoulos et al. 2000; Mendes-Ferreira et al. 2002).

Por otra parte, las levaduras de vino pueden produ-cir compuestos volátiles de azufre beneficiosos para la calidad del vino. Algunos de estos son el furfuril-tiol, un compuesto identificado en el aroma del Pinot Manseng blanco, tintos de Burdeos, y en las duelas tostadas (Tominaga et al. 2000). El furfuriltiol es un aromatizante extremadamente potente (umbral de percepción de 0,4 ng/l) y también se ha identificado en el café tostado, la carne, el pan de trigo y en las palomitas de maíz. Se cree que la levadura forma el furfuriltiol mediante la transformación del furfural li-berado durante la fermentación a partir de las duelas de roble tostadas (Tominaga et al. 2000).

Otros tioles volátiles que mejoran el aroma produ-cidos por la levadura a partir de los precursores de la uva son el 4-mercapto-4-metilpentano- 2-ona (4MMP), el 3-mercaptohexan-1-ol (3MH) y el acetato de 3-mercaptohexilo (3MHA). Los tioles volátiles son extremadamente potentes y tienen umbrales de per-cepción bajos: 0,8 ng/l (4MMP), 60 ng/l (3MH) y 4 ng/l (3MHA). En los Sauvignon Blanc, estos compuestos son de particular importancia para diversos caracteres dado que ofrecen aromas a “boje” (4MMP), “maracuyá”, “pomelo”, “grosella espinosa” y guayaba (3MH y 3MHA; Tominaga et al. 1995, 1998a,b; Dubourdieu et al. 2006). No obstante, también se han identificado 4MMP, 3MH y 3MHA en distintas concentraciones en vinos elabo-rados a partir de uvas Colombard, Riesling, Semillon, Merlot y Cabernet Sauvignon, por lo que también po-drían afectar al aroma y la calidad de tales vinos (Tomi-naga et al. 1995, 1998a,b; Murat et al. 2001b).

El desafío de la enología moderna es limitar (o elimi-nar) la producción de H

2S y mercaptanos indeseables

y, al mismo tiempo, mejorar la producción de tioles volátiles beneficiosos. El uso de sulfato de cobre in-troduce un interesante dilema para el vinicultor, ya que es utilizado para tratar vinos contaminados con H

2S y mercaptanos, pero al mismo tiempo reduce la

concentración de tioles volátiles deseables ya que el ión Cu2+ no discrimina entre los dos tipos de com-puestos de azufre. Por tanto, la mejor solución yace en el desarrollo de levaduras que produzcan durante la fermentación concentraciones absolutas y relativas de tioles volátiles que mejoren el aroma sin la forma-ción de H

2S ni mercaptanos (Pretorius 2000; Pretorius

y Bauer 2002). En el siguiente apartado de este do-cumento se detallan los elementos metabólicos de la

levadura del vino que resultan en la producción de compuestos volátiles de azufre. Además, se discuten los últimos avances en la modificación del metabolis-mo del azufre de la levadura del vino para mejorar el sabor y el aroma del vino.

2.- Mecanismo de formación de azufre volátil

2.1 Formación de sulfuro de hidrógeno a través de la ruta de secuencia de reducción de sulfato.

La levadura del vino puede formar metabólicamen-te H

2S a partir de compuestos inorgánicos de azufre

como los sulfatos y sulfitos, así como de compuestos orgánicos como la cisteína y el glutatión (Henschke y Jiranek 1993; Rauhut 1993; Hallinan et al. 1999; Spi-ropoulos et al. 2000). En general, la uva debe ser de-ficiente en compuestos orgánicos de azufre, ya que éstos pueden activar la síntesis de tales compuestos de azufre a partir de fuentes inorgánicas habitual-mente abundantes en el mosto (Henschke y Jiranek 1993; Park et al. 2000; Moreira et al. 2002). En la S. ce-revisiae, H

2S es el producto de la ruta de la secuencia

de reducción de sulfato (SRS) (Fig. 1; Yamagata 1989; Rauhut 1993). En la ruta SRS, el H

2S procede del ión

HS-, un intermedio metabólico de la reducción del sulfato o sulfito necesario para la síntesis de com-puestos orgánicos de azufre. Si durante la fermenta-ción estas reacciones se producen en presencia de un

Fig. 1 Un diagrama que representa la ruta SRS y la biosíntesis de aminoácidos en S. cerevisiae. Adenosil 5′-fosfosulfato (APS); 3′-fosfoadenosil

5′-fosfosulfato (PAPS); O-acetilserina (O-AS); O-acetlilhomoserina (O-AH)

52

Seminario Técnico


aporte adecuado de nitrógeno, el ión HS- es captado por la O-acetilserina y la O-acetilhomoserina, que son productos derivados del metabolismo del nitrógeno, para formar compuestos orgánicos de azufre como metionina y cisteína (Henschke y Jiranek 1993; Park et al. 2000; Moreira et al. 2002). Sin embargo cuando las fuentes de nitrógeno son insuficiente o inadecuadas, el H

2S puede acumularse en la célula y pasar al mosto

en fermentación por difusión (Vos y Gray 1979; Hens-chke y Jiranek 1991; Giudici y Kunkee 1994; Jiranek et al. 1995, 1996).

Parece que, al menos parcialmente, la capacidad de producción de H

2S de una cepa determinada es gené-

tica, ya que la producción de H2S de diferentes cepas

varía en las mismas condiciones (Thornton y Bunker 1989; Henschke y Jiranek 1993; Jiranek et al. 1995; Spi-ropoulos et al. 2000). El primer paso de la ruta meta-bólica SRS implica el transporte del sulfato desde el medio hasta la célula de levadura mediante la sulfato permeasa. El sulfato se reduce a continuación a sulfu-ro a través de una serie de pasos que implican el uso de la enzima ATP-sulfurilasa (que emplea dos molécu-las de ATP) y de la sulfito reductasa. El siguiente paso conduce la captación del sulfuro: la O-acetilserina (del aminoácido serina) se combina con el sulfuro para for-mar cisteína, y la O-acetilhomoserina (del aminoácido aspartato) se combina con el sulfuro para formar ho-mocisteína, la cual se puede convertir en metionina (Thornton y Bunker 1989; Yamagata 1989; Henschke y Jiranek 1993; Rauhut 1993; Jiranek et al. 1995; Spiro-poulos et al. 2000).

Dado que las concentraciones de cisteína y metionina en los zumos de uva habitualmente no son suficientes para cubrir las necesidades metabólicas de las células en crecimiento, se activa la ruta metabólica SRS para cubrir esta demanda (Henschke y Jiranek 1993). Cuan-do existe una cantidad adecuada de nitrógeno en el medio, existirán suficientes precursores de estos ami-noácidos (O-acetilserina y O-acetilhomoserina) para captar el sulfuro. Si la cantidad de nitrógeno es limi-tada, no habrá suficientes precursores; la ruta SRS se activará y el sulfuro se acumulará debido a la ausencia de precursores. El exceso de sulfuro se libera de las cé-lulas en forma de H

2S (Henschke y Jiranek 1993; Rau-

hut 1993; Jiranek et al. 1995; Spiropoulos et al. 2000). Algunas veces, se producen cantidades importantes de H

2S cuando en el producto en fermentación hay

sulfito, el cual se difunde hacia las células. Por tanto, en condiciones de poco nitrógeno, se observa una producción elevada y continua de H

2S en presencia

de sulfito (Jiranek et al. 1995; Hallinan et al. 1999).

Otros factores ambientales que pueden afectar a la pro-ducción de H

2S son (1) niveles elevados de azufre ele-

mental, (2) presencia de dióxido de azufre, (3) presencia de compuestos orgánicos con azufre, (4) deficiencia de pantotenato, (5) alto contenido relativo de treoni-na con respecto a otros aminoácido y (6) de metionina

con respecto a la concentración de amonio (Henschke y Jiranek 1991; Rauhut 1993; Spiropoulos et al. 2000).

En un estudio se ha investigado recientemente el papel de la enzima bifuncional O-acetilserina/O-acetilhomoserina tiolasa como medio para modular la producción de H

2S por la levadura industrial (Spi-

ropoulos y Bisson 2000). El estudio demostró que la sobreexpresión del gen MET17, que codifica la O-acetilserina/O-acetilhomoserina tiolasa, en una cepa de S. cerevisiae originó que se formara mucho menos H

2S en un vino en fermentación. Sin embargo esto no

sucedió en otra cepa de S. cerevisiae con sobreexpre-sión de MET17, lo que indica que la actividad de la O-acetilserina/O-acetilhomoserina tiolasa no está di-rectamente relacionada con la formación de H

2S (Spi-

ropoulos y Bisson 2000).

Se ha demostrado que la sobreexpresión de dos ge-nes, el MET14, que codifica una adenosilfosfosulfato cinasa, y SSU1, que codifica un portador de sulfito, au-menta la formación de sulfito (Donalies y Stahl 2002). Por tanto, se ha postulado que la ausencia del gen MET14 o del gen MRX1, que codifican una metionina sulfoxido reductasa, podría ser la manera más eficaz de impedir que la levadura del vino produzca H

2S

durante la fermentación (Pretorius 2000, 2003, 2004; Pretorius y Høj 2005).

Otro método para evitar la formación de H2S fue la

modificación de la actividad de la enzima sulfito re-ductasa mediante la alteración de una de las subuni-dades de la enzima (Sutherland et al. 2003). La sulfito reductasa es un heterotetrámero compuesto de dos subunidades α y dos subunidades β, las cuales son codificadas por los genes MET10 y MET5 respectiva-mente (Sutherland et al. 2003). La enzima, una hemo-flavoproteína, enlaza los cofactores flavín adenina dinucleótido, flavín mononucleótido y sirohemo. Se introdujeron mutaciones en el gen MET10 de modo que la subunidad α no se pudiera enlazar a los cofac-tores pero pudiera formar aun un complejo proteínico heterotetrámetro con la subunidad β. De este modo, la sobreexpresión del gen MET10 mutante produciría una subunidad no funcional que podría reducir la pro-porción de sulfito reductasa funcional en la célula, y por tanto reducir la formación de sulfuro. Sin embar-go, es necesario investigar más para confirmar si esta estrategia es capaz de evitar la formación de H

2S en el

vino en fermentación.

El H2S es muy reactivo y se puede combinar con otros

componentes del vino para formar compuestos vo-látiles de azufre relacionados (Vermeulen et al. 2005). Por ejemplo, el etanotiol se puede formar por reac-ción de H

2S con etanol o acetaldehído (Amerine et al.

1980; Rauhut 1993). En el vino, se piensa que la for-mación de disulfuro de dimetilo, trisulfuro de dime-tilo y tetrasulfuro de dimetilo se produce mediante la oxidación del metanotiol, un compuesto que se con-

Text

os a

soci

ados

53


sidera procedente de la descomposición de la metio-nina (Rauhut 1993). La concentración de disulfuro de dimetilo encontrada en algunos vinos está muy por encima del umbral sensorial de 25 μg/l (vino blanco) y 60 μg/l (vino tinto; Rauhut 1993). En bajas concen-traciones, se considera que el disulfuro de dimetilo es un compuesto beneficioso que contribuye al aroma asociado al tiempo de maduración en botella (Rauhut 1993; Ribéreau-Gayon et al. 2000).

2.2. Formación de tioles volátiles mediante la levadura a través de carbono tiolasas

Se ha propuesto que la formación de furfuriltiol a partir de furfural por la S. cerevisiae es catalizada por la enzima cisteína desulfidrasa, la cual es necesaria para la produc-ción de cisteína (Tominaga et al. 2000). Por tanto el anión HS- se produce a través de esta enzima, originando la formación de H

2S. La formación de H

2S mejora a su vez

la formación de furfuriltiol a partir de furfural. Esto se ha confirmado al observar que el vino en fermentación con una fuente añadida de nitrógeno (por tanto se inhibe la formación de H

2S) no produce tanto furfuriltiol. Por con-

siguiente, la producción de furfuriltiol se vincula a la pro-ducción del anión HS-, el cual no se produce cuando el sulfato de amonio se añade a un caldo en fermentación en cantidades suficientes (Tominaga et al. 2000).

Los tioles volátiles 4MMP, 3MH y 3MHA son práctica-mente inexistentes en el zumo de uva y solamente se desarrollan durante la fermentación (Fig. 2). No obs-tante, se ha demostrado que 4MMP y 3MH existen en la uva en forma de conjugados enlazados a la cisteína no volátiles y que la levadura del vino es responsa-ble de extraer el tiol del precursor (Darriet et al. 1995). Ciertos experimentos demuestran que una célula de un extracto de enzima libre de célula de la Eubacte-rium limosum (que contiene enzimas carbono–tiola-sa) podría liberar 4MMP de su precursor S-4-(4-metil-pentan-2-ona)-Lcisteína (Cis-4MMP) lo que indica que la presencia de un mecanismo similar de liberación a través de las carbono-tio-lasas de la levadura es más probable durante la fermentación del vino (Tominaga et al. 1995). La hipótesis de Tominaga et al. (1995) se comprobó investigando la capacidad de la levadura de liberar 4MMP a partir de Cis-4MMP cuando se eli-minan los genes que codifican las posibles carbono-tio-lasas en una cepa de laboratorio de S. cerevisiae (Howell et al. 2005). Cuatro genes, identificados como responsables de las posibles enzimas carbono–tio-lasas, influyeron en la liberación del tiol volátil 4MMP, lo que indica que el mecanismo de liberación implica probablemente varios genes. Se eliminaron también los genes identificados en una variación homocigosa de la levadura comercial VL3, y el resultado mostró que la eliminación de los cuatro genes asociados a la car-bono–tio-lasa conducía a una disminución de la can-tidad de 4MMP liberado (Howell et al. 2005). En este

último estudio no se observó que la sobreexpresión de estos genes produjera un aumento de la liberación de 4MMP. No obstante, recientemente, nuestro gru-po sobreexpresó un gen heterolocigoso que codifica una enzima carbono-tio-lasa en una levadura comer-cial ampliamente utilizada (VIN13) y demostró como conclusión que, en vinos en fermentación modelos, la cepa VIN13 modificada liberaba diez veces más 4MMP y 3MH de sus precursores sintetizados químicamente que la cepa control VIN13. Además, el vino Sauvignon Blanc producido por la levadura modificada tuvo un muy potente aroma no detectado en el vino control. Por tanto, es posible modificar levaduras para utilizar más precursores de tioles derivados de la uva y por tanto mejorar el aroma del vino (Swiegers et al. sin publicar).

Se ha demostrado anteriormente que la cantidad liberada de 4MMP en el vino depende de qué cepa de levadura se utilice para llevar a cabo la fermenta-ción (Dubourdieu et al. 2006). Por tanto, la genética y la fisiología de la cepa determinan su capacidad para liberar tioles volátiles. Algunos estudios del primer tra-bajo indicaron que las cepas comercialmente disponi-bles de S. cerevisiae VL3 y EG8 liberan más tioles que las cepas VL1 y 522d. Además, las cepas de Saccha-romyces bayanus liberan más 4MMP que las cepas de S.cerevisiae VL3 y EG8. Los vinos confeccionados con cepas híbridas de S.bayanus/S. cerevisiae muestran un contenido superior de tioles volátiles (Murat et al. 2001b). Estos hallazgos se han confirmado al observar que diferentes cepas comerciales tienen capacidades diferentes de liberación de 4MMP a partir del precursor Cis-4MMP en vinos modelo en fermentación (Howell et al. 2004). Howell et al. (2004) han identificado cepas comerciales de levaduras que liberan aún más tioles que VL3. En un estudio de seguimiento, el Sauvignon Blanc producido por siete cepas diferentes de leva-dura del vino (VL3 entre ellas) mostró perfiles únicos de tioles volátiles, siendo la cepa VIN7 la que produ-jo mayor concentración de 4MMP y 3MHA, mientras que VIN13 produjo mayores concentraciones de 3MH (Swiegers et al. 2006). Se ha demostrado que durante la fermentación, el 3MHA se forma a partir del 3MH por la acción de la alcohol acetiltransferasa que forma és-teres y que es codificada por el gen ATF1 (Swiegers et al. 2005b). La sobreexpresión del gen ATF1 en la cepa de levadura VIN13 produjo un aumento significativo de la cantidad de 3MHA producido. Por otra parte, la sobreexpresión del gen IAH1, el cual codifica un enzi-ma que descompone ésteres, produjo una reducción en la concentración de 3MHA. También se investigó la capacidad de diferentes levaduras comerciales para convertir 3MH en 3MHA durante la fermentación. Se observaron grandes variaciones en la concentración de 3MHA y, en la mayoría de los casos, no correspon-dían con la capacidad de liberación de 4MMP de las levaduras (Swiegers et al. 2005b). Por tanto, queda puesto de manifiesto que la selección de la cepa de levadura es de máxima importancia en la modulación

54

Seminario Técnico


de las concentraciones de tioles en el vino.

Se ha demostrado que cuando disminuye la con-centración del precursor de tioles S-3- (hexan-1-ol)-L-cisteina (Cis-3MH), aumenta la cantidad de 3MH durante la fermentación. No obstante, solamente una pequeña fracción (1,6%) del precursor enlazado a la cisteína presente originalmente se libera como 3MH (Dubourdieu et al. 2006). Además en mostos Cabernet Sauvignon y Merlot, se ha observado que la cantidad de 3MH liberada era proporcional a la concentración de Cis-3MH presente al inicio de la fermentación. Por tanto, cuanto mayor es la concentración de precur-sores de tioles conjugados a la cisteína en el mosto, mayor es la concentración de tioles volátiles en el vino resultante (Murat et al. 2001a). No obstante, en el estu-dio anterior, solamente el 3,2% del precursor presente originalmente en el mosto se liberó en forma de tioles volátiles durante la fermentación.

Recientemente se ha determinado el impacto de la temperatura de fermentación sobre la concentración de tioles volátiles en un medio modelo y en zumo de uva. Se demostró que las concentraciones de 4MMP, 3MH y 3MHA fueron mayores cuando se produjo la

fermentación alcohólica a 20 °C con respecto a 13°C, independientemente de la cepa utilizada (Masneuf Pomarède et al. 2006). Por el contrario, Swiegers et al. (2006) ha demostrado que en vinos en fermentación modelos, se libera más 4MMP y más 3MH se convierte en 3MHA a bajas temperaturas (18°C) en compara-ción con altas temperaturas (23 y 28 °C) al final de la fermentación. No obstante, al principio de la fermen-tación, hay más tioles volátiles en los caldos en fer-mentación más calientes (Swiegers et al. 2006).

3. Conclusión

El objetivo final de todo vinicultor es conseguir un vino con unas características óptimas de calidad, pre-cio y apariencia al consumidor (Pretorius 2006). Para lograr este objetivo, es necesario un control exhausti-vo del método de producción, de las condiciones de fermentación, de la elección de la cepa de levadura y de la producción de componentes que afectan favo-rablemente a la calidad organoléptica del vino.

Los compuestos volátiles de azufre son aromatizantes y saborizantes potentes que pueden tener un efecto

Fig. 2 El vino es una mezcla muy compleja de compuestos derivados de la uva, de los microorganismo y, en algunos casos, del roble, que definen en gran medida su apariencia, aroma, sabor y sensaciones en el paladar (Swiegers et al. 2005ª). Los compuestos

derivados de la uva distinguen al vino por su variedad y lo dotan de su estructura básica. La fermentación de los azúcares por parte de las levaduras no sólo produce etanol y dióxido de carbono, sino que también una gama de metabolitos menores pero importantes organolépticamente que proporcionan el carácter del vino. Estos metabolitos volátiles que son ésteres, alcoholes

superiores, carbonilos, ácidos grasos volátiles y compuestos de azufre, son derivados del metabolismo de los azúcares y de los aminoácidos. Los tioles volátiles, particularmente 4MMP, 3MH y 3MHA, contribuyen de manera importante al aroma de los vinos, particularmente en variedades como la Sauvignon Blanc. Durante la fermentación del vino, la S. cerevisiae favorece la división de precursores no volátiles con cisteína (Cis-4MMP y Cis-3MH) existente el zumo de uva para liberar 4MMP y 3MH. La ausencia de

tioles volátiles en la uva indica la importancia de la fermentación de la levadura para su formación (Swiegers et al. 2006)

Text

os a

soci

ados

55


considerable sobre la calidad del vino. Las levaduras de vino son las principales generadoras de compues-tos volátiles de azufre, los cuales son producidos a par-tir de fuentes de azufre y precursores derivados de las uvas (y en algunos casos por productos añadidos por el vinicultor, e.g., SO2). A día de hoy se han conseguido avances significativos para dilucidar las rutas metabó-licas responsables de la formación de compuestos vo-látiles de azufre. Este conocimiento se está utilizando actualmente para desarrollar cepas de levaduras de vino que: (1) produzcan nada o mucho menos sulfuro de hidrógeno y mercaptanos asociados y (2) tengan una mayor capacidad de producir compuestos voláti-les de azufre deseables que aporten aromas afrutados al vino. En algunos casos, se ha aplicado ingeniería genética con el objetivo de evaluar la viabilidad del diseño de tales cepas para lograr los resultados desea-dos. Si bien los consumidores actuales son aún muy resistentes a consumir bebidas producidas por micro-organismos modificados genéticamente, la reciente comercialización de una levadura genéticamente modificada en la industria vitivinícola norteamerica-na podría indicar la aceptación gradual de esta tec-nología (Husnik et al.2006). No obstante, aunque en el futuro cercano no se utilice para producir vino co-

mercial ninguna de estas levaduras genéticamente modificadas con metabolismos del azufre alterados, sirven como modelos y prototipos útiles para aportar más información que podría aplicarse para desarrollar cepas no modificadas genéticamente utilizando téc-nicas más convencionales (por ejemplo, mutagénesis, hibridación y evolución adaptativa). Por tanto, existe un gran consenso sobre la posibilidad de confeccio-nar a medida levaduras de vino sin acudir a ingeniería genética. Sin embargo, para personalizar levaduras no modificadas genéticamente con el fin de que los vini-cultores ajusten las concentraciones de compuestos que determinan la calidad del vino, el conocimiento fundamental requerido continuará generándose am-pliamente a partir de información obtenida mediante cepas prototipo modificadas genéticamente.

Agradecimientos: la investigación en el Australian Wine Research Institute (Instituto de Investigación Enológica de Australia) es posible gracias al apoyo de viticultores y vinicultores australianos a través de su organismo inversor, la Grape y Wine Research Deve-lopment Corporation, la cual financia según una me-todología “matching funds” junto al Gobierno austra-liano.

Referencias

Amerine MA, Berg HV, Kunkee RE, Ough CS, Sin-gleton VL, Webb AD (1980) The technology of wine-making, 4th edn. AVI Technical Books, Westport, CT

Bonnarme P, Psoni L, Spinnler HE (2000) Diversity of L-methionine catabolism pathways in cheese-ripe-ning bacteria. Appl Environ Microbiol 66:5514–5517

Dainty RH, Edwards RA, Hibbard CM, Marnewick JJ (1989) Volatile compounds associated with micro-bial growth on normal and high pH beef stored at chill temperatures. J Appl Bacteriol 66:281–289

Darriet P, Tominaga T, Lavigne V, Boidron J, Du-bourdieu D (1995) Identification of a powerful aro-matic compound of Vitis vinifera L. var. Sauvignon wi-nes: 4-mercapto-4-methylpentan-2-one. Flavour Fragr J 10:385–392

Donalies UEB, Stahl U (2002) Increasing sulfite for-mation in Saccharomyces cerevisiae by overexpres-sion of MET14 and SSU1. Yeast 19:475–484

Dubourdieu D, Tominaga T, Masneuf I, Peyrot des Gachons C, Murat ML (2006) The role of yeasts in grape flavor development during fermentation: the example of Sauvignon Blanc. Am J Enol Vitic 57:81–88

Giudici P, Kunkee RE (1994) The effect of nitrogen deficiency and sulfur-containing amino acids on the reduction of sulfate to hydrogen sulfide by wine yeasts. Am J Enol Vitic 45:107–112

Hallinan CP, Saul DJ, Jiranek V (1999) Differential utilization of sulfur compounds for H2S liberation by nitrogen-starved wine yeast. Austral J Grape Wine Res 5:82–90

Henschke PA, Jiranek V (1991) Hydrogen sulfide formation during fermentation: effect of nitrogen composition in model grape must. Proceedings of the international symposium on nitrogen in grapes and wine, Seattle, USA. American Society for Enology and Viticulture, Davis, CA, pp 172–184

Henschke PA, Jiranek V (1993) Yeast−growth during fermentation. In: Fleet GH (ed) Wine microbiology and biotechnology. Harwood Academic, Chur, Switzerland, pp 27–54

Howell KS, Swiegers JH, Elsey GM, Siebert TE, Bar-towsky EJ, Fleet GH, Pretorius IS, de Barros Lopes MA (2004) Variation in 4-mercapto-4-methyl-pentan-2-one release by Saccharomyces cerevisiae commer-cial wine strains. FEMS Microbiol Lett 240:125–129

56

Seminario Técnico


Howell KS, Klein M, Swiegers JH, Hayasaka Y, Elsey GM, Fleet GH, Høj PB, Pretorius IS, de Barros Lo-pes MA (2005) Genetic determinants of volatile thiol release by Saccharomyces cerevisiae during wine fer-mentation. Appl Environ Microbiol 71:5420–5426

Husnik JI, Volschenk H, Bauer J, Colavizza D, Luo Z, van Vuuren HJ (2006) Metabolic engineering of malolactic wine yeast. Metab Eng 8(4):315–323

Jiranek V, Langridge P, Henschke PA (1995) Valida-tion of bismuthcontaining indicator media for predic-ting H2S producing potential of Saccharomyces cere-visiae wine yeasts under enological conditions. Am J Enol Vitic 46:269–273

Jiranek V, Langridge P, Henschke PA (1996) De-termination of sulphite reductase activity and its res-ponse to assimilable nitrogen status in a commercial Saccharomyces cerevisiae wine yeast. J Appl Bacteriol 81:329–336

Kappler U, Dahl C (2001) Enzymology and molecu-lar biology of prokaryotic sulfite oxidation. FEMS Mi-crobiol Lett 203:1–9

Masneuf-Pomarède I, Le Jeune C, Durrens P, Lo-llier M, Aigle M, Dubourdieu D (2006) Influence of fermentation temperature on volatile thiols concen-trations in Sauvignon blanc wines. Int J Food Micro-biol 108:385–390

Mendes-Ferreira A, Mendes-Faia A, Leao C (2002) Survey of hydrogen sulphide production by wine yeasts. J Food Prot 65:1033–1037

Morales P, Fernandez-Garcia E, Nunez M (2005) Volatile compounds produced in cheese by Pseudo-monas strains of dairy origin belonging to six different species. J Agric Food Chem 53:6835–6843

Moreira N, Mendes F, Pereira O, Guedes de Pin-ho P, Hogg T, Vasconcelos I (2002) Volatile sulphur compounds in wines related to yeast metabolism and nitrogen composition of grape musts. Anal Chim Acta 458:157–167

Murat ML, Masneuf I, Darriet P, Lavigne V, Tomi-naga T, Dubourdieu D (2001a) Effect of Saccha-romyces cerevisiae yeast strains on the liberation of volatile thiols in Sauvignon Blanc wine. Am J Enol Vitic 52:136–139

Murat ML, Tominaga T, Dubourdieu D (2001b) As-sessing the aromatic potential of Cabernet Sauvignon and Merlot musts used to produce rose wine by assa-ying the cysteinylated precursor of 3-mercaptohexan-1-ol. J Agric Food Chem 49:5412–5417

Park SK, Boulton RB, Noble AC (2000) Formation of hydrogen sulfide and glutathione during fermenta-tion of white grape musts. Am J Enol Vitic 51:91–97

Pretorius IS (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking. Yeast 16:675–729

Pretorius IS (2003) The genetic analysis and tailoring of wine yeasts. In: de Winde JH (ed) Genetics and ge-nomics of industrial yeasts. Springer, Berlin Heidelberg New York, pp 99–134

Pretorius IS (2004) The genetic improvement of wine yeasts. In: Arora DK, Bridge PD, Bhatnagar (eds) Handbook of fungal biotechnology. Marcel Dekker, New York, USA, pp 183–223

Pretorius IS (2006) Grape and wine biotechnology: setting new goals for the design of improved grape-vines, wine yeast and malolactic bacteria. In: Hui HY, Barta J, Cano MP, Gusek T, Sidhu JS, Sinha N (eds) Han-dbook of fruits processing science and technology. Blackwell, Ames, IA, USA, pp 453–489

Pretorius IS, Bauer FF (2002) Meeting the consumer challenge through genetically customized wine-yeast strains. Trends Biotechnol 20:426–432

Pretorius IS, Høj PB (2005) Grape and wine biotech-nology: challenges, opportunities and potential bene-fits. Austral J Grape Wine Res 11:83–108

Purdy KJ, Embley TM, Nedwell DB (2002) The dis-tribution and activity of sulphate reducing bacteria in estuarine and coastal marine sediments. Antonie Van Leeuwenhoek 81:181–187

Rauhut D (1993) Yeasts−production of sulfur com-pounds. In: Fleet GH (ed) Wine microbiology and bio-technology. Harwood Academic, Chur, Switzerland, pp 183–223

Ribéreau-Gayon P, Dubourdieu D, Donéche B, Lonvaud A (2000) Handbook of Enology, vol 1: the microbiology of wines and vinification. Wiley, Chi-chester, UK, p 454

Russell SM, Fletcher DL, Cox NA (1995) Spoilage bacteria of freshbroiler chicken carcasses. Poult Sci 74:2041–2047 Seefeldt KE, Weimer BC (2000) Diversity of sulfur compound production in lactic acid bacteria. J Dairy Sci 83:2740–2746

Spiropoulos A, Bisson LF (2000) MET17 and hydro-gen sulfide formation in Saccharomycescerevisiae. Appl Environ Microbiol 66:4421–4426

Text

os a

soci

ados

57

Capítulo

Spiropoulos A, Tanaka J, Flerianos I, Bisson LF (2000) Characterization of hydrogen sulfide forma-tion in commercial and natural wine isolates of Sac-charomyces. Am J Enol Vitic 51:233–248

Swiegers JH, Pretorius IS (2005) Yeast modulation of wine flavour. Adv Appl Microbiol 57:131–175

Swiegers JH, Bartowsky EJ, Henschke PA, Preto-rius IS (2005a) Yeast and bacterial modulation of wine aroma and flavour. Austral J Grape Wine Res 11:139–173

Swiegers JH, Willmott R, Hill-Ling A, Capone DL, Pardon KH, Elsey GM, Howell KS, de Barros Lopes MA, Sefton MA, Lilly M,

Pretorius IS (2005b) Modulation of volatile thiol and ester aromas in wine by modified wine yeast. Procee-dings of the Weurman flavour research symposium, Roskilde, Denmark, 21– 24 June 2005, Developments in Food Science, Elsevier, Amsterdam, The Nether-lands

Swiegers JH, Francis IL, Herderich MJ, Pretorius IS (2006) Meeting consumer expectations through management in vineyard and winery: the choice of yeast for fermentation offers great potential to adjust the aroma of Sauvignon Blanc wine. Austral NZ Wine Ind J 21:34–42

Sutherland CM, Henschke PA, Langridge P, de Ba-rros Lopes M (2003) Subunit and cofactor binding of Saccharomyces cerevisiae sulfite reductase−towards developing wine yeast with lowered ability to produce hydrogen sulfide. Austral J Grape Wine Res 9:186–193

Thornton RJ, Bunker A (1989) Characterisation of wine yeasts for genetically modifiable properties. J Inst Brew 95:181–184

Tominaga T, Masneuf I, Dubourdieu D (1995) A S-cysteine conjugate, precursor of aroma of white sau-vignon. J Int Sci Vigne Vin 29:227–232

Tominaga T, Peyrot des Gachons C, Dubourdieu D (1998a) A new type of flavour precursors in Vitis vinifera L. cv. Sauvignon Blanc: S-cysteine conjugates. J Agric Food Chem 46:5215–5219

Tominaga T, Furrer A, Henry R, Dubourdieu D (1998b) Identification of new volatile thiols in the aroma of Vitis vinifera L. var. Sauvignon Blanc wines. Flavour Fragr J 13:159–162

Tominaga T, Blanchard L, Darriet P, Dubourdieu D (2000). A powerful aromatic volatile thiol, 2-furan-methanethiol, exhibiting roast coffee aroma in wines made from several Vitis vinifera grape varieties. J Agric Food Chem 48:1799–1802

Vermeulen C, Gijs L, Collin S (2005) Sensorial con-tribution and formation pathways of thiols in foods: a review. Food Rev Int 21:69–137

Vos PJA, Gray RS (1979) The origin and control of hydrogen sulphide during fermentation of grape must. Am J Enol Vitic 30:187–197

Yamagata S (1989) Roles of O-acetyl-L-homose-rine sulfhydrylases in micro-organisms. Biochimie 71:1125–1143

58

Seminario Técnico


Una revolución en el sector enólogico: Levaduras de vinificación que no producen Sulfuro de hidrógeno (H2S)

Cordente, T.; Swiegers, H.; (Australian Wine Research Institute AWRI), Heinrich, A.; (Mauri Yeast Australia)

El artículo íntegramente reproducido a continuación se publico por primera vez en la revista The Australian and New Zealand Grapegrover ans Winemaker Magazine en noviembre de 2007. Publicado con el permiso de la cita-da revista .

Las cepas de levadura descritas en este artículo como su correspondiente proceso de desarrollo están pendientes de patente.

Introducción

La producción excesiva de Sulfuro de Hidrógeno (H2S)

que tiene lugar en el transcurso del proceso de fer-mentación del mosto constituye un problema bas-tante común en lo que a vinificación se refiere (Monk 1986; Henschke and Jiranek 1991). El principal motivo de ello radica en la baja concentración de elementos nitrogenados en el medio. Con el objeto de paliar este problema, los enologos pueden, en el transcur-so del proceso de fermentación, aumentar el grado de nitrógeno en el mosto, añadiéndole fosfato dia-mónico (DAP) o utilizando sulfato de cobre después de la fermentación con el fin de suprimir el H

2S del

vino. Pero a pesar del aporte en DAP, la levadura sigue produciendo H

2S en algunos medios y todo ello sin

hablar del hecho de que la mayoría de los enólogos preferiría no tener que recurrir al uso del sulfato de cobre. Los vinos que contienen H

2S desprenden un

olor desagradable (a huevo podrido), pero además, debido a su olor, el H

2S, no solo reduce las cualidades

organolépticas del vino sino también oculta las notas aromáticas favorables de éste.

¿Cabría imaginar que en el futuro podamos llevar a cabo una fermentación con levaduras de vinificación que no produzcan H

2S detectable sea cual sea el con-

tenido en nitrógeno asimilable del medio y sin ningún aporte en DAP? Por otro lado, ¿Estas cepas de leva-dura serían capaces de realzar aromas favorecedores

manteniendo a la vez una excelente capacidad de fermentación? El Instituto de Investigación Vitivinícola de Australia (AWRI) ha desarrollado, en colaboración con la Sociedad Mauri Yeast Australia, nuevas cepas de levadura que producen cantidades indetectables de H

2S. Estas levaduras son Advantage, Platinum y

Distinction.

¿Cómo han sido desarrolladas estás levaduras de baja producción de H2S?

Para el desarrollo de estas cepas, el AWRI ha utilizado métodos biológicos clásicos (no OGM). La cepa Mau-rivin PDM era la cepa parental ideal, dada la populari-dad de la que goza entre los elaboradores a nivel in-ternacional. El objetivo radicaba en adaptar la cepa de manera que ésta realzara sus propiedades favorables, es decir su capacidad en no producir cantidades de-tectables de H

2S y a partir de ella se han obtenido las

cepas cuyos ensayos se exponen a continuación.

Estas cepas, pendientes de patente, están clasificadas como “no OGM” en todos los países vitivinícolas del mundo.

Probar las cepas en mostos empobrecidos en nitrógeno asimilable

Las cepas seleccionadas se probaron en mostos que contenían bajas cantidades de nitrógeno asimilable (100 mg. N/L). No se añadió ningún aporte en DAP durante el proceso de fermentación. Las fermenta-ciones de laboratorio se realizaron a 18º C, por tri-plicado, con una concentración inicial en azúcar de 240 gr./lt. (aproximadamente 13.5 B). Unas cintas reactivas (tipo Fluka) extremadamente sensibles al H

2S fueron insertadas en cada frasco con el fin de

poner en evidencia la producción de H2S; las cintas

blancas, indicaban la ausencia de liberación de H2S.

Las cintas de color marrón indicaban, por otra parte, una presencia de H

2S en cantidades indetectables

para el olfato humano. Las cintas negras indicaban en cambio una presencia de H

2S más allá del límite

perceptible por el olfato humano aún que en un ni-vel de concentración no perjudicial para la calidad del vino.

Al finalizar la fermentación, las cintas reactivas su-mergidas en las muestras que contenían Advantage y Distinction se quedaron blancas o de color muy claro Platinum (Figura 1) Este resultado confirmó que estas cepas no producían cantidades detectables de H

2S, incluso en presencia de cantidades muy bajas de

nitrógeno asimilable. El patrón , Maurivin PDM, que-do claramente coloreado. Conviene destacar que en los mostos que contenían cantidades suficientes de nitrógeno asimilable, Maurivin PDM no produjo nada de H

2S.

The Australian and New Zealand Grapegrover ans Winemaker Magazine, noviembre de 2007

Text

os a

soci

ados

59

Una revolución en el sector enólogico: Levaduras de vinificación que no producen Sulfuro de hidrógeno

Estos resultados demuestran que estas tres cepas Ad-vantage, Platinum y Distinction, fermentan mostos empobrecidos en nitrógeno asimilable sin producir cantidades de H

2S detectables por la nariz humana.

Asimismo, estas tres cepas de levadura presentan cinéticas de fermentación comparables con las de la cepa de levadura PDM, conocida por su robustez (Tabla 1, Figura 2).

Y en condiciones reales de vinificación

Las cepas han sido probadas en condiciones reales de vinificación con el fin de reflejar su aptitud en las con-diciones ambientales propias al vino. Se sometió a prueba un mosto de Chardonnay con una concentra-ción de azúcar de 190 gr./lt. Y, al igual que en la prueba anterior, no se añadió DAP en todo el transcurso del proceso de fermentación. Utilizando condiciones de fermentación similares a las anteriormente descritas, la fermentación se llevó a cabo a una temperatura de 15º C y, de la misma manera, los grados de fermenta-ción obtenidos fueron similares a los obtenidos con la cepa testigo de referencia (Maurivin PDM). Las cintas reactivas de todos los mostos de Chardonnay fermentados con las tres nuevas cepas se quedaron blancas. Hecho que confirma que, sin ningún aporte en DAP estas cepas no producen H

2S con la variedad

Chardonnay.

Las catas tampoco revelaron presencia alguna de H2S.

Los catadores indicaron la presencia de notas afruta-das, dada la ausencia de notas azufradas. Estas cepas de levadura presentan pues con la variedad Chardon-nay, unas capacidades de fermentación indudables; y por este motivo fueron sometidas a prueba otras variedades con el fin de confirmar dicha aptitud fer-mentaría.

Resultados obtenidos con la variedad Sauvignon Blanc

A lo largo de este estudio, se uso un mosto de Sau-vignon Blanc para llevar a cabo la fermentación, con el objetivo de marcar más las diferencias sensoriales usando una variedad aromática. El mosto presentaba las características analíticas siguientes: 190 gr./lt. de azúcar, pH 3.3, acidez total de 5.1 gr./lt. Las fermen-taciones se realizaron a una temperatura 18°C. Las cintas reactivas confirmaron de nuevo que en ausen-cia de cualquier aporte de DAP las cepas Advantage, Distinction y Platinum no producían H

2S mientras

que en el mismo tiempo, la cepa testigo producía una

cantidad de H2S que sobrepasaba el límite de la per-

cepción sensorial.

Las catas llevadas a cabo al finalizar el análisis demos-traron que los vinos presentaban características sen-soriales positivas. Además, las cepas revelaron unas cinéticas de fermentación comparables a la obtenida con la cepa Maurivin PDM .

En resumen

La producción de H2S es perjudicial para la produc-

ción de vinos de calidad. Felizmente, hoy en día, exis-ten cepas de levaduras llamadas Advantage, Platinum Distinction.. Estas cepas se adaptan especialmente a los mostos que, empobrecidos en nitrógeno, evi-tan la producción de H

2S. Por lo general se trata de

cepas polivalentes que permiten la fermentación de una amplia gama de variedades a la vez que una pro-ducción de vinos de calidad con características sen-soriales considerablemente mejoradas. Además, al no tener que recurrir al DAP (o emplearlo en cantidades inferiores) se facilita así el procesos de vinificación.

Agradecimientos

Los autores dan las gracias al Dr. Nick Yap, al Dr. Dan Johnson y al Profesor Sakkie Pretorius por su valio-sa colaboración a lo largo de todo este proyecto así como por la crítica constructiva que hicieron de este artículo. El Dr. Toni Cordente se ha beneficiado del apoyo económico del grupo AB Mauri. El Dr.Hentie Swiegers es investigador en el Instituto de Investi-gación Vitivinícola de Autralia, subvencionado por la asociación de los vinificadores y viticultores Australia-nos a través de su organismo de inversión: la sociedad de Desarrollo de la Investigación sobre Uva y Vino así como por los fondos del gobierno de Australia.

Referencias

Monk, P.R. Formation, utilization and excretion of hydrogen sulfide by wine yeast. (1986) Wine Indus-try Journal, Noviembre 10-16.

Henschke PA, Jiranek V (1991) Hydrogen sulfide formation during fermentation: effect of nitrogen composition in model grape must. Proceedings of the international symposium on nitrogen in grapes and wine, Seattle, USA. American Society for Enology and Viticulture, Davis, CA, Pág.172–184

60

Seminario Técnico


Figura 1. Cintas reactivas cuyo color negro indica la presencia de pequeñas cantidades de H2S

Figura 2. Cinética de fermentación de distintas cepas de levadura

Tabla 1. Análisis químicos de los vinos

PDM Advantage Platinum Distinction

Azúcar residual (Fructosa) gr./lt. 1.7 1.2 0.2 0

Glicerol gr./lt. 4.8 5.8 5.2 5.3

Ácido acético gr./lt. 0.28 0.35 0.06 0.20

Etanol % 11.4 11.3 11.3 11.5

Días de fermentación (<2 gr./lt.) 17 19 12 12

Text

os a

soci

ados

61

Seminario Técnico


Nitrogen management is critical for wine Managing Director, flavour and style

Ugliano, M.; Henschke, P.A.; Herderich, M.J.; Pretorius, I.S.

The Australian Wine Research Institute, PO Box 197, Glen Osmond (Adelaide), South Australia 5064, Australia

“Winemaking begins in the vineyard” is a mantra that has widespread support amongst winemakers. It conveys the concept of vineyard or, in French jar-gon, terroir as an intrinsic property of grape, and consequently the corresponding wine. There is no doubt that many great wines are associated with great vineyards. So, where do yeast fi t in?

The perception that fermentation yeast faithfully transform grape must into wine has been changing in the detail over the past decades. This is a result of science uncovering the many roles that yeast per-form, and the wider selection of strains available that promote these various attributes. For example, whe-reas most strains produce a relatively similar, generic, fermentation bouquet only some strains possess a strong ability to hydrolyse cysteine conjugates res-ponsible for Sauvignon Blanc character, meaning that only selected strains can enhance varietal expression (Swiegers et al. 2006).

Winemakers today have many options through fer-mentation management to enhance the varietal cha-racteristics of their wine, or to express further regional attributes. Furthermore, yeast strongly respond to their environment. It is well known that temperatu-re aff ects the rate of fermentation, that grape solids enhance survival and that high osmotic stress, as imposed by a Botrytis-aff ected must, leads not only to increased glycerol production but also to higher volatile acidity. The latter example highlights the re-markable ability of yeast to adapt to stressful (i.e. high sugar) environments. However, there is an accompan-ying metabolic adaptation which can have positive or negative fl avour implications.

At the time of inoculation, yeast are subjected to a range of stresses to which the cell must adapt in order to exploit its new environment. Some of the known stresses are osmotic pressure, oxidative conditions,

sulphite toxicity and temperature shock (Bauer and Pretorius 2000). Nutrients, whether present in sub- or super-optimal concentration, can also induce stress and metabolic responses. The primary response is aimed at protecting the cell from committing to re-production when key nutrients are lacking or dealing with potential toxicity when the concentration is out-side the normal range. The metabolic response often involves a cascade of biochemical reactions, some of which can lead to altered metabolism of nutrients such that the yeast will secrete end-products in diff erent amounts (Albers et al. 1998). Some of the end products that have sensory properties can lead to changes in the fl avour profi le of the wine. H

2S for-

mation is an all-too-well known example relating to nitrogen depletion stress.

Clearly, the vineyard environment and intervention by the viticulturist shape the development of the vine and especially the composition of the grape. Because the viticulturist attempts to balance a long list of prio-rities in order to produce fruit to specifi cation, most attention will focus on those factors that cannot be modifi ed once the fruit has been harvested.

Therefore, yeast nutrients, especially nitrogen, might not be optimised for fermentation, largely in the belief that nutrients can be easily corrected in the winery. Gi-ven that we estimate that up to 500t of diammonium phosphate (DAP) could be used each year to produce Australian wine, is this winemaking input being used eff ectively? Our current state of knowledge on the implications of controlling vineyard nitrogen as oppo-sed to fermentation nitrogen on fermentation perfor-mance and wine composition has been recently re-viewed by Bell and Henschke (2005). In this article, we will focus on the role that fermentation nitrogen has in modulating metabolism and some of the changes that this can have on wine fl avour. We will fi rst sum-marise current best practice for managing fermen-tation nitrogen and then describe the main fl avour changes that are aff ected by nitrogen.

Finally, we will consider the fl avour implications of ni-trogen for white and red wine fermentations.

CURRENT BEST PRACTICE FOR MANAGING FERMENTATION NITROGEN

A common practice amongst winemakers is to make a standard addition of DAP to the juice or must (100-300mg/L) at inoculation without measuring the ni-trogen concentration. This article will show that DAP addition has signifi cant fl avour consequences and that measuring the initial nitrogen concentration pro-vides the opportunity to adjust DAP addition not only to achieve an adequate fermentation rate, but also to more reliably guide the fl avour profi le and style of wine required. This work is still in a conceptual stage

Wine Industry Journal > Vol 22 No 6 > November / December 2007

Text

os a

soci

ados

63


based on studies with Chardonnay and Shiraz; howe-ver, it should stimulate winemakers to experiment with these and other varieties.

1.1 Measuring YAN

Grapes contain a variety of nitrogenous compounds of which the most important are the primary or alpha amino acids, ammonium ion and small peptides. Pro-line, a dominant secondary amino acid in many gra-pe varieties, cannot be assimilated under anaerobic conditions (Ingledew et al. 1987). These nitrogenous compounds, excluding proline, constitute what is commonly referred to as yeast assimilable nitrogen (YAN).

Because amino acids are chemicallydiverse mole-cules, the most convenient measure of assimilable nitrogen relates to assaying the free or alpha-amino group of the primary amino acids, which is commonly referred to as free amino nitrogen (FAN). Proline, a se-condary amino acid, and protein are excluded in FAN assay methods. Of the several chemical, enzymatic and physical methods available (Shively and Henick- Kling 2001; Bell and Henschke 2005; Filipe-Ribereiro and Mendes-Faia 2007) the method of choice is the o-phthaldialdehyde/N-acetyl-L-cysteine (NOPA) me-thod (Dukes and Butzke 1998). An additional enzy-matic method is needed to determine ammonia, of which 82% is nitrogen. Summation of these two nitro-

gen measurements yields YAN (Figure 1). This proce-dure is used by NATA-accredited laboratories such as AWRI’s Analytical Service laboratory (http://www.awri.com.au/analytical_ service/analyses/yeast_assimilable_ nitrogen/), which can provide a timely service during vintage.

The so-called Formol Titration is a simpler, rapid me-thod for measuring YAN (Shively and Henick-Kling 2001; Gump et al. 2002; Filipe-Ribereiro and Mendes-Faia 2005), although the use of formaldehyde, a toxic volatile reagent, requires a well-trained analyst and suitable laboratory. YAN determination with mid-infrared (MIR) spectrometry, which is most rapid, has recently been developed by the AWRI (Dambergs et al. 2005).

YAN measurements, ideally, should be performed di-rectly on juice or must samples at the point of ino-culation to avoid over-estimation due to processing losses which inevitably occur between vineyard and the fermentor. Furthermore, juice samples taken from grape musts can under-estimate total berry YAN due to an important proportion of amino acid contained in the grape skin. Refer to the review by Bell and Hens-chke (2005) for a detailed discussion of these points.

Nevertheless, an early warning for low YAN can be achieved by sampling in the vineyard one to two wee-ks prior to harvest, such as during maturity sampling.

1.2 Supplementing must YANThe YAN content of Australian grape juices varies wi-dely from approximately 50-350mg/L, with a mean value of around 200mg/L. As a benchmark, it is gene-rally agreed that maximum yeast biomass yield and fermentation rate results when YAN exceeds 400mg/L, whereas 150mg/L YAN marks a transition zone, below which the risk of slow or stuck fermentation notably increases (Henschke and Jiranek 1993; Blateyron et al. 2003). Since much of the background research work to establish these benchmarks has been carried out in synthetic and fi ltered grape juices, this risk value is technically only valid for highly clarifi ed, anaero-bic, juice fermentations. Nonetheless, it represents a worst-case scenario and is a useful guide for other ty-pes of fermentation.

In general, in order to achieve an adequate rate of fermentation to dryness, a cellar bright juice contai-ning <150mg/L YAN should be supplemented with nitrogen to at least 150-200mg/L when the respec-tive vineyard has a history of low YAN fermentation problems or a high nitrogen-demanding yeast has been selected. Nitrogen supplementation should be increased to the higher end of the range for higher °Brix juices, whereas juices containing grape solids, or fermentations that are aerated, are less susceptible to low YAN diffi culties (Ribéreau-Gayon et al. 2000; Bla-teyron et al. 2003; Eglinton et al. 2005). Later on in this

Figure 1. Summation of free amino nitrogen and ammonia nitrogen levels provides a useful estimate of the yeast assimilable nitrogen level.

64

Seminario Técnico


article, when we consider the fl avour consequences of juice YAN content, some winemakers might choose to supplement low YAN juices up to a fi nal concentra-tion of 250-300mg/L YAN so as to produce a cleaner, fruitier style.

DAP is widely used as a YAN supplement for this pur-pose. DAP contains 21% N, therefore, for convenience we can consider 100mg DAP to contain 20mg YAN. By way of an example, it will be necessary to add 500mg/L DAP to a juice to increase its YAN concentration from 100mg/L to 200mg/L. While this fi gure seems a lar-ge addition of DAP, the YAN equivalent of 1.5g DAP would be needed to reach the point at which maxi-mum fermentation rate would be achieved. Austra-lian winemakers can visit the AWRI website to access the calculator to estimate DAP additions: http://www.awri.com.au/ practical_solutions/calculators/.

One disadvantage of DAP as a supplement is the aci-difi cation that can result in some juices, leading to a lowerthan- expected wine pH. Utilisation of the ammonium cation by yeast leaves a notable propor-tion of the phosphate anion, which can lower pH, depending on initial pH and must titratable acidity (TA). Furthermore, large additions of DAP can lead to excessive wine phosphate content. In practice, the maximum addition of DAP is limited by the concomi-tant concentration of soluble phosphate remaining in the wine, which is set at 400mg P/L (Australian and New Zealand Food Standard 4.5.1). This concentration of phosphate-P would correspond to a maximum of 1.7g/L

DAP (equivalent to 360mg/L YAN) if we assume that the juice/must contained no phosphate; in practice a lesser amount of DAP can only, therefore, be added.

Overuse of DAP can also stimulate overproduction of acetate esters, especially ethyl acetate, resulting in the perception of volatile acidity (VA) and suppression of varietal character. As discussed in the following sec-tions, high YAN (exceeding 450-500mg/L YAN) can stimulate ethyl acetate production by many yeast strains.

When working with very low YAN juices, we have ob-served that other nutrients can similarly be low. Thus, when YAN is low and other nutrient defi ciencies are suspected, it can be useful to add a proprietary yeast food that contains more complex forms of N, as well as vitamins, lipids and minerals. Indeed, continued H2S production after DAP addition suggests a general vitamin defi ciency (Henschke 1996; Wang et al. 2003), though other causes are also possible.

Most yeast suppliers can advise on the use of yeast foods, which are generally produced from inactivated yeast.

GENERAL METABOLIC RESPONSES OF YEAST TO YAN

The principal role of sugar metabolism in yeast is to generate energy and carbon skeletons for building all the components of the cell. These metabolic activities result in the accumulation of several by-products, in-cluding esters, higher alcohols and polyols, carbonyls, acids and thiols which contribute to the aroma and fl avour of wine. Nitrogen metabolism, which is invol-ved in the assimilation of nitrogen for the synthesis of protein and nucleic acids, also contributes to the pool of aroma and fl avour compounds. Because nitrogen metabolism is central to cell growth, it regulates other pathways, including sugar and sulphur metabolism. Consequently, nitrogen availability can signifi cantly impact on the production of many fl avouractive me-tabolites. The nitrogen status of a juice or must, there-fore, contributes to wine fl avour as well as aff ecting yeast growth and the fermentation of sugars.

2.1 Major fermentation products

In addition to ethanol and CO2, other major products

of sugar metabolism are the polyols, such as glycerol and butanediol and the organic acids, especially ace-tic and succinic acids and, to a lesser extent, the ke-toacids, such as pyruvic acid and -ketoglutaric acid.

The production of many of these primary metabolites of sugar metabolism is modulated by YAN, although the magnitude of changes has been observed to depend on the yeast strain under consideration. Fur-thermore, the type of nitrogen source used, DAP or amino acids, aff ects metabolite production (Albers et al. 1996). Because low YAN juices are typically supple-mented with DAP, only the impact of ammonium ion concentration on the production of yeast metabolites will be discussed in this article.

Figure 2. Effect of yeast assimilable nitrogen on production or utilisation of major metabolic

products of sugar fermentation and sulphur assimilation.

Glycerol

Aceticacid

100 200 300 400

Malicacid

YAN

Conc

entra

tion

Succinicacid

SO2

Text

os a

soci

ados

65


Ethanol is the major product of sugar fermentation. However, while DAP addition increases yeast growth and the rate of fermentation, it has little to no practical eff ect on fi nal ethanol yield.

Theoretically, DAP-grown yeast are forced to synthesi-se amino acids for cell growth when compared with amino acid grown yeast. This decreases the propor-tion of sugar available for ethanol production (Albers et al. 1996), but in our experiments this has a minor aff ect on ethanol yield.

Glycerol and acetic acid, which are important to wine composition and fl avour, respond relatively strongly to juice YAN concentration (Albers et al. 1998; Torrea et al. 2005; Vilanova et al. 2007).

Figure 2 summarises general trends observed in syn-thetic juice and white wine fermentations. Both gly-cerol and acetic acid production depends strongly on the yeast strain used. For example, when using yeast Vitilevure M05 DAP addition increases glycerol production whereas the reverse is the case for AWRI 796 (Vilanova et al. 2007). Both yeast, however, pro-duce the lowest concentrations of acetic acid at mo-derate YAN concentrations (range of 200-250mg/L) while higher concentrations are produced at both lower and higher concentrations of YAN. Malic acid consumption does, however, increase with increasing DAP concentration, irrespective of yeast strain. On the contrary and depending on the strain, succinic acid concentration can increase with increasing DAP addi-tion (Coulter et al. 2004). In general, YAN can aff ect TA and the balance of organic acids which can aff ect fl avour (Sowalsky and Noble 1998).

Sulphur dioxide production during fermentation can also be stimulated by initial YAN concentration, but the response seems to be yeast strain dependent. Experimental work in synthetic media and wort su-ggests that low SO2 is produced in low YAN media but increases when initial YAN availability is higher (Duan et al. 2004; Osborne and Edwards 2006). SO

2

production contrasts with H2S production, which is generally lowered by increasing YAN. Increased risk of MLF inhibition has also been associated with high YAN addition but this inhibition has not been conclu-sively correlated with SO

2 production (Osborne and

Edwards 2006). Nevertheless, until better information is available, consideration should be given to limiting high YAN conditions when malolactic fermentation (MLF) is required.

2.2 Volatile aroma compounds

Among the various yeast metabolic pathways that are infl uenced by the nitrogen composition of the juice, those leading to volatile compounds are of particular importance due to the primary role played by fermen-

tation-derived volatiles in the aroma character of wine (Smyth et al. 2005). Several studies have indicated that both the total available nitrogen and the balance of amino acids and ammonia can signifi cantly aff ect the production of different groups of fermentation-derived volatile compounds.

From a practical point of view, the problem of juice ni-trogen composition is primarily linked to the frequent occurrence of juices with suboptimal concentrations of nitrogen, and higher risk of slow or stuck fermen-tation. As this problem is frequently corrected in the winery through the addition of DAP, several studies have investigated the implications of this common winery practice on the volatile composition of wine (Ayrapaa 1971, Rapp and Versini 1991; Carrau 2003; To-rrea and Henschke 2004; Hernandez-Orte et al. 2005, 2006; Vilanova et al. 2007). Due to the variety of yeast strains and fermentation conditions employed, it is somewhat diffi cult to extrapolate from the literature defi nitive conclusions concerning the eff ect of DAP addition on wine aroma. Nevertheless, some general trends relating to DAP supplementation and wine vo-latile composition are summarised in Figure 3.

Higher alcohols, which are directly related to amino acid metabolism in the cell, exhibit a characteristic behaviour. Therefore, when total nitrogen is increased by adding ammonium to a medium containing very low levels of YAN, the production of higher alcohols is initially increased, but then tends to decrease after a peak between 200-300mg/L YAN. This activity de-pends on various factors, including yeast strain and fermentation conditions.Higher alcohols are charac-terised by fusel-like odours, and are generally thought to contribute to the complexity of wine fermenta-tion bouquet. However, when present in very high concentrations they can have a negative impact on wine aroma, mainly because they mask fruity charac-ters. Several authors have reported that ammonium supplementation can improve wine sensory quality

Ethyl acetate

Higher alcohols

Fatty acids ethyl esters

Branched chain esters

Acetate esters

100 200 300 400 500YAN

Conc

entra

tion

of y

east

aro

ma

com

poun

ds

Figure 3. Relationship between initial YAN concentration and fi nal concentration of volatile

compounds after fermentation.

66

Seminario Técnico


by lowering higher alcohols production (Rapp and Versini 1991). However, based on the trend shown in Figure 3, this advice has to be taken cautiously as it might apply only to fermentations with initial YAN in the range included in the descending part of higher alcohols production pattern, i.e. YAN >200mg N/L.

The production of fatty acids ethyl esters, as well as of acetate esters, including ethyl acetate, is generally in-creased when DAP is added to the juice prior to alco-holic fermentation (Figure 3). This can have interesting implications for wine fl avour as fatty acids ethyl esters and acetates are generally responsible for the frui-ty character of wine (Guth and Sies 2002). However, ethyl acetate, one of the dominant yeast-derived vo-latile metabolites, when present at very high concen-trations, can give unwanted sensory characteristics, often described with terms like nail lacquer/solvent and volatile acidity. Branched chain esters are, from a quantitative point of view, the less abundant volatiles produced during fermentation. Although their contri-bution to wine fl avour has still to be clarifi ed, ten-tative evidence is available in the literature for these compounds to be important contributors to the red berry fruit character of some red wines (Diaz- Maroto et al. 2005). Their concentration appears to decrease with increased DAP additions, however.

The existence of a variety of diff erent responses for the various groups of yeastderived volatile com-pounds to DAP supplementation arises from the fact that each group of volatiles is derived from a diff erent metabolic pathway, each of which respond differently to DAP supplementation. However, from a practical point of view, understanding the potential of DAP supplementation as a tool to modulate wine sensory characteristics cannot be based simply on composi-tional data. The various volatiles or groups of volatiles illustrated in Figure 3 occur in wine over an extremely broad range of concentrations. However, this fi gure does not represent the actual quantitative relations-hip between diff erent chemical species. For example, higher alcohols, characterised by herbaceous, fusel-like odours, typically occur in concentrations that can be up to 400 times higher than ethyl fatty acid esters,

characterised by fruit-like odours. Nevertheless, relati-vely small variations in the concentration of ethyl fatty acid esters, such as those introduced by variations in YAN content, are more likely to aff ect the aroma of wine than if proportionally similar variations would occur for higher alcohols. This is due to the fact that some of the possible sensory modifi cations associa-ted with changes in the concentration of specifi c aroma compounds depend, among other factors, on the ability of that aroma compound to generate an olfactory stimulus at a given concentration.

This complex relationship is often simplifi ed by means of the concept of odour threshold, defi ned as the minimum concentration at which a given com-pound can be detected by the sense of smell (Guth 1997). This is referred to as the odour activity value (OAV). Some of the fermentation-derived volatile compounds, such as esters, that are generally asso-ciated with the fruity character of wine, are extremely powerful odourants (i.e. have a very low odour thres-hold) and can, therefore, impart specifi c sensory attri-butes even when present in low concentrations. On the contrary, compounds like higher alcohols possess a much higher odour threshold and, therefore, are likely to generate variations in the aroma profi le of a wine only when their concentration varies to a very large extent. In Figure 4, a theoretical relationship bet-ween the OAV of selected volatile compounds, belon-ging to the chemical classes of Figure 3, and DAP su-pplementation is illustrated. It appears clear then that the range of variations potentially introduced by DAP in the concentration of acetates and fatty acid ethyl esters (isoamyl acetate and ethyl octanoate are used as reference compounds for these two classes) can have a dramatic impact on the volatile character of wine, whereas variations in compounds such as hig-her alcohols (isoamyl alcohol), although quantitatively extremely large, are likely to have a limited impact. Although it has to be stressed that OAVs only give a projection of the potential of a given compound to contribute to the overall aroma of a wine, the trends shown in Figure 4 provide a good indication of which one of the compositional changes associated with DAP supplementation is likely to have a greater im-pact on wine aroma.

IMPLICATIONS OF NITROGEN FOR WINE FERMENTATIONS

3.1 Implications of nitrogen for white wine fermentations

Interestingly, the results obtained in various winema-king trials conducted at the AWRI with sub-optimal YAN juices have indicated that, under typical winema-king conditions, DAP supplementation is an extremely powerful tool for modulating the production of esters which, based on the previous discussion, are probably

Isoamyl alcoholEthyl octanoateIsoamyl acetateEthyl 3Ethyl acetate

0

20

40

60

80

100

120

-methylbutanoate

YAN

Odou

r Act

ivity

Val

ue

100 200 300 400 500

Figure 4. Theoretical relationship between initial YAN concentration and Odour Activity Values of

selected yeast-derived aroma compounds.

Text

os a

soci

ados

67


the most sensorially-interesting group of compounds generated during fermentation. Figures 5 and 6 show the variations in volatile compounds and the sensory profi le of Chardonnay wines made at diff erent DAP concentrations. In good agreement with the trends shown in Figure 3, DAP had a positive eff ect on ester production, while it lowered the formation of higher alcohols. However, the wines obtained with moderate nitrogen supplementation of the juice were preferred by panellists compared with those obtained without or with high DAP addition. This preference might be due to a combination of higher acetates, ethyl fatty acid ester concentrations and moderate levels of ethyl acetate, the latter being associated with unwanted, solvent-like characteristics when present at very high concentrations. DAP addition to low YAN juices also suppresses the production of H2S and mercaptans by many wine yeasts, which although not quantifi ed in this study, no doubt contributed to the preference of the moderate YAN wines. The impact of DAP addition on the production of fruity thiols, such as 4MMP, 3MH and 3MHA, still needs to be determined.

These results highlight the complexity of predicting wine aroma from compositional data. They also un-derline the importance of measuring YAN and adding the appropriate amount of DAP, if necessary, before or during fermentation in order to reduce the potentially negative eff ects that inadequate or excessive DAP su-pplementation can have on wine aroma. Particularly, the risk of excessive formation of ethyl acetate has to be considered as this ester is relatively stable during wine ageing, compared with other acetate and ethyl fatty acid esters, which tend to decrease signifi cantly after several months of bottle storage.

3.2 Implications of nitrogen for red wine fermentations

More recently, researchers at the AWRI have investiga-ted the eff ect of DAP supplementation on the volatile composition of Shiraz wine (Ugliano et al. 2007). It is ge-nerally believed that the conditions normally adopted for the production of red wine (i.e. higher temperatures, aeration of the fermenting must during cap manage-ment operations, extraction of YAN and other nutrients from skin during maceration) render fermentations less susceptible to slow or stuck fermentations, even when YAN concentrations approach the sub-optimal range. Nevertheless, several surveys have shown that YAN levels in red grapes can be well below optimal (Goc-kowiak and Henschke 1992; Butzke 1998; Nicolini et al. 2004; Ugliano and Henschke, unpublished data).

Although during red wine fermentations YAN defi ciencies are likely to have a more moderate eff ect on fermentation kinetics, they can still negatively aff ect the formation of important aroma compounds. From the results of a trial which was carried out on a low YAN Shiraz must (YAN 100mg/L) with S. cerevisiae AWRI 796, it is again clearly evident that DAP supple-mentation is a powerful tool for modulating the vola-tile composition of red wine. This confi rms some of the trends observed during experiments with model substrates and white grape juices. As can be seen in Figure 7, DAP supplementation resulted in higher pro-duction of ethyl fatty acid esters and acetate esters, while higher alcohols were scarcely affected.

Preliminary results also indicated that YAN supple-mentation of must can have an impact on red wine

0

2000

4000

6000

8000

10,000

12,000

Fatty acids ethyl esters Acetates Higher alcohols/100

Conc

entra

tion

µg/L

160mg/L YAN 320mg/L YAN 480mg/L YAN

Ethyl acetate/10

0

0.5

1

1.5

2

2.5

3

3.5

4

0

0.5

1

1.5

2

2.5

3

3.5

4Banana

Fruit ester

Artificial grape

Musk

Floral

Stewed fruit

Tropical

CitrusBruised apple

Honey

Stale beer

Nail lacquer

Acetic

Cheesy

Sweaty

Wet cardboard

Less

pre

ferr

ed a

rom

as

More preferred arom

as

Figure 5. Volatile compounds of wines obtained from a low YAN (160mg/L) Chardonnay juice

supplemented with two increasing concentrations of DAP, to a fi nal YAN of 320mg/L and 480mg/L, respectively. Fermentations were carried out at

18ºC using S. cerevisiae AWRI 796.

Figure 6. Sensory characteristics of wines obtained from a low YAN (160mg/L) Chardonnay juice

(green line) supplemented with two increasing concentrations of DAP, to a fi nal YAN of 320mg/L (red line) and 480mg/L (blue line), respectively.

Fermentations were carried out at 18ºC using S. cerevisiae AWRI 796.

68

Seminario Técnico


colour composition. Analytical parameters related to colour intensity and hue were indeed found to vary with DAP supplementation (Ugliano et al. 2007). The factors responsible for this eff ect are currently being investigated at the AWRI. The eff ect might be ascri-bable to various aspects of yeast metabolism that are known to modulate wine colour and phenolics composition. Factors include variations in the rate of ethanol production, absorption of anthocyanins on yeast cell walls (Morata et al. 2003) or reactions with yeast-derived metabolites such as pyruvic acid and acetaldehyde to form pigmented polymers (Romero and Bakker 1999).

CONCLUSION

This work shows that the concentration of yeast as-similable nitrogen is not only important for ensuring that adequate yeast growth and fermentation kinetics are achieved, but also can aff ect the production of the major metabolites arising from sugar fermenta-tion. Whereas ethanol concentration is little aff ected, that of glycerol and various carboxylic acids can be markedly modulated. These changes are likely to aff ect wine fl avour. Most importantly, however, is the fi nding that YAN can strongly infl uence production of some of the volatile metabolites, especially the ace-tate and ethyl esters, which are known to be positive to wine aroma when in balance. The impact of higher alcohols, which can be negative when present in high concentration, can also be modulated by YAN. These various yeast metabolites were also found to vary in

red wine fermentations, suggesting that, as in white wines, must YAN can aff ect the development of wine fl avour. Our preliminary data suggest that wine colo-ur and phenolics composition can also be infl uenced by YAN.

Overall, these results suggest that, at least for Char-donnay, the fl avour and style of wine is dramatically modulated by the initial YAN concentration of the gra-pe juice. Low YAN level juices favour the production of more complex wines with less fruity aromas, whereas moderate YAN levels produce cleaner and fruitier wi-nes. However, high YAN levels can lead to excessively estery wines. Similar eff ects can be expected in other varieties, excepting for those varieties that depend on thiols, for which no information is presently available. Clearly, more wine sensory studies need to be under-taken to better understand the eff ects of must YAN and amino acid profi le on wine fl avour.

A red wine trial is currently in progress to understand better the impacts of managing nitrogen in the vi-neyard compared with that in the winery on wine fl avour and quality. This research can be expected to provide grapegrowers and winemakers with better information for optimising wine style and quality ac-cording to consumer preferences and other desired outcomes.

ACKNOWLEDGEMENTS

We thank our many colleagues for supporting this project, especially Tracey Siebert and Dimitra Capone for help with analysis of fermentation volatiles; Ma-riola Kwiatkowski and Meagan Mercurio for analysis of phenolic compounds; Kate Lattey, Belinda Bra-mley and Dr Leigh Francis for carrying out the sen-sory analyses; Industry Development and Support and Analytical Service team members for help with chemical analyses; and Dr Paul Chambers, Dr Cris-tian Varela and Biosciences team members for many helpful discussions. Professor Francisco Carrau, of Uruguay, and visiting scientists Drs Diego Torrea and Mar Vilanova, from Spain, have made important con-tributions to this project. We are especially grateful to Mike Farmilo, of Boar’s Rock winery, for supplying a large number of juice samples and donating must for the Shiraz fermentation trials, and Russell Johnstone and Inca Pearce, of Orlando Wines, and Louisa Rose and Simon Dillon of The Yalumba Wine Company, for supplying white wine juices. Current work on nitro-gen management also involves collaboration with Dr Sally-Jean Bell and Marcel Essling. Rae Blair is thanked for her editorial assistance. This project is supported by Australia’s grapegrowers and winemakers through their investment agency, the Grape and Wine Re-search and Development Corporation, with matching funds from the Australian Government. The AWRI is a member of the Wine Innovation Cluster.

Figure 7. Volatile compounds of wines obtained from low YAN (100mg/L YAN) Shiraz grapes

supplemented with two increasing concentrations of DAP, to a fi nal YAN of 250mg/L and 400mg/L

respectively. Fermentations were carried out at 22ºC using S. cerevisiae AWRI 796, with cap

plunging three times per day.

0

1000

2000

3000

4000

5000

6000

7000

8000

9000

10,000

Fatty acids ethyl esters Acetates

100mg/L YAN 250mg/L YAN 400mg/L YAN

Conc

entra

tion

µg/L

Ethyl acetate Higher alcohols/100

Text

os a

soci

ados

69


REFERENCES

1 Albers, E.; Larsson, C.; Liden, G.; Niklasson, C. & Gustafsson, L. (1996) Infl uence of the nitrogen source on Saccharomyces cerevisiae anaerobic growth and product formation. Appl. Env. Microbiol. 62: 3187-3195.

2 Albers, E.; Lidén, G.; Larsson, C.; Gustafsson, L. (1998) Anaerobic redox balance and nitrogen me-tabolism in Saccharomyces cerevisiae. Recent Res.

Develop. Microbiol. 2: 253-279; 1998.

3 Äyräpää, T. (1971) Biosynthetic formation of higher alcohols by yeast.

Dependence on the nitrogenous nutrient level of the medium. J. Inst.

Brew. 77: 266-276.

4 Bauer, F.F.; Pretorius, I.S. (2000). Yeast stress res-ponse and fermentation effi ciency: how to survive the making of wine – A review. S. Afr. J. Enol. Vitic. 21: 27-51.

5 Bell, S.-J.; Henschke, P.A. (2005) Implications of ni-trogen nutrition for grapes, fermentation and wine. Aust. J. Grape Wine Res. 11: 242-295.

6 Blateyron, L.; Ortiz-Julien, A; Sablayrolles, J.M. (2003) Stuck fermentations: oxygen and nitrogen requirements – importance of optimising their addi-tion. Aust. N.Z. Grapegrower Winemaker 478: 73-79.

7 Butzke, C. (1998). Survey of Yeast Assimilable Ni-trogen status in musts from California, Oregon, and Washington. Am. J. Enol. Vitic. 49: 220-224.

8 Carrau, F.M. (2003) Characterization of yeast in re-lation to the ability to utilize nitrogen – Studies of aroma compounds. PhD thesis, Universidad de la Republica, Uruguay.

9 Coulter, A.D.; Godden, P.W.; Pretorius, I.S. (2004) Succinic acid-how is it formed, what is its eff ect on titratable acidity, and what factors infl uence its con-centration in wine? Aust. N.Z. Wine Ind. J. 19: 16-20, 22-25.

10 Dambergs, R.G.; Kambouris, B.; Cynkar, W.; Ja-nik, L.J.; Cozzolino, D.; Henschke, P.A.; Gishen, M. (2005) A comparison of near infrared and mid-infrared spectroscopy for the analysis of yeast-assi-milable nitrogen in grape juice. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of the twelfth Australian wine industry technical conference; 24-29 July 2004; Melbourne, Vic. Australian Wine Indus-try Technical Conference Inc., Adelaide SA: 334.

11 Diaz-Maroto, M.C.; Schneider, R.; Baumes, R. (2005) Formation pathways of ethyl esters of bran-ched short-chain fatty acids during wine aging. J. Agric Food Chem., 53, 3503-3509.

12 Duan, W.; Roddick, F.A.; Higgins, V.J.; Rogers, P.J. (2004) A parallel analysis of H2S and SO2 formation by brewing yeast in response to sulphur-containing amino acids and ammonium ions. J. Am. Soc. Brew. Chem. 62: 35-41.

13 Dukes, B.C.; Butzke, C.E. (1998) Rapid determina-tion of primary amino acids in grape juice using an o-phthaldialdehyde/N-acetyl-L-cysteine spectro-photometric assay. Am. J. Enol. Vitic. 49: 125-134.

14 Eglinton, J.; Siebert, T.; Kwaitkowski, M.; Fran-cis, L.; Henschke P. (2005) Compositional and sen-sory implications of practical strategies for ensuring complete fermentation with non-conventional yeast. Blair, R.J.; Williams, P.J.; Pretorius, I.S.(eds.) Pro-ceedings of the twelfth Australian wine industry te-chnical conference; 24-29 July 2004; Melbourne, Vic. Australian Wine Industry Technical Conference Inc., Adelaide SA: 288.

15 Filipe-Ribeiro, L.; Mendes-Faia, A. (2007) Vali-dation and comparison of analytical methods used to evaluate the nitrogen status of grape juice. Food Chem. 100: 1272-1277.

16 Gockowiak, H.; Henschke, P.A. (1992) Nitrogen composition of grape juice and implications for fer-mentation: results of a survey made in N-E Victoria. Aust Grapegrower Winemaker 340: 131, 133-138.

17 Gump, B.H.; Zoecklein, B.W.; Fugelsang, K.C.; Whiton, R.S. (2002) Comparison of analytical me-thods for prediction of prefermentation nutritional status of grape juice. Am. J. Enol. Vitic. 53: 325-329.

18 Guth, H. (1997) Quantitation and sensory studies of character impact odorants of diff erent white wi-nes varieties. J. Agric. Food Chem., 45: 3027-3032.

19 Guth, H.; Sies, A. (2002) Flavour of wines: Towards an understanding by reconstitution experiments and an analysis of ethanol’s eff ect on odour activity of key compounds. Blair, R.J.; Williams, P.J.; Høj, P.B. (eds.). Proceedings of the eleventh Australian Wine Industry Technical Conference, 7-11 October 2001, Adelaide SA. Australian Wine Industry Technical Conference Inc., Adelaide SA 128-139.

20 Henschke, P.A. (1996) Hydrogen sulphide pro-duction by yeast during fermentation. Proceedings Eleventh international oenological symposium, So-pron, Hungary (International Association for Winery Technology and Management: Breisach, Germany) pp. 83-102.

70

Seminario Técnico


21 Henschke, P.A.; Jiranek, V. (1993) Yeasts – meta-bolism of nitrogen compounds. In: Wine Microbio-logy and Biotechnology. Fleet, G.H. (ed.) (Harwood Academic Publishers: Chur, Switzerland) pp. 77-164.

22 Hernández-Orte, P.; Ibarz, M.J.; Cacho, J.; Ferrei-ra V. (2005) Eff ect of the addition of ammonium and amino acids to must of Airen variety on aroma-tic composition and sensory properties of the ob-tained wines. Food Chem. 89: 163-174.

23 Hernández-Orte, P.; Bely, M.; Cacho, J.; Ferrei-ra, V. (2006) Impact of ammonium additions on volatile acidity, ethanol, and aromatic compounds production by diff erent Saccharomyces cerevisiae strains during fermentation in controlled synthetic media. Aust. J. Grape. Wine Res. 12: 150-160.

24 Ingledew, W.M.; Magnus, C.A.; Sosulski, F.W. (1987) Infl uence of oxygen on proline utilization during wine fermentation. Am. J. Enol. Vitic. 38: 246-248.

25 Morata, A.; Gomez-Cordoves, M.C.; Suberviola, J.; Bartolomé, B.; Colomo, B.; Suárez, J.A. (2003) Adsorption of anthocyanins by cell walls during the fermentation of red wines. J. Agric. Food. Chem. 51, 4084-4088.

26 Nicolini, G.; Larcher, R.; Versini, G. (2004) Status of yeast assimilable nitrogen in Italian grape musts and eff ect of variety, ripening and vintage. Vitis, 43: 89-96.

27 Osborne, J.P.; Edwards, C.G. (2006) Inhibition of malolactic fermentation by Saccharomyces during alcoholic fermentation under low- and highnitro-gen conditions: a study in synthetic media. Aust. J. Grape Wine Res. 12: 69-78.

28 Rapp, A.; Versini, G. (1991). Infl uence of nitro-gen compounds in grapes on aroma compounds of wine. Proceedings of the International Symposium on Nitrogen in Grapes and Wine. Davis USA: American Society for Enology and Viticulture, 156-164.

29 Ribéreau-Gayon, J.; Dubourdieu, D.; Donéche, B.; Lonvaud, A. (2000) Handbook of Enology, Vo-lume 1: The microbiology of wines and vinifi cation. John Wiley & Sons Ltd: Chichester, UK.: 454.

30 Romero C.; Bakker, J. (1999) Interactions bet-ween grape anthocyanins and pyruvic acid, with eff ect of pH and acid concentration on anthocyanin composition and color in model systems. J. Agric. Food Chem. 47, 3130-3139.

31 Shively, C.E.; Henick-Kling, T. (2001) Comparison of two procedures for assay of free amino nitrogen. Am. J. Enol. Vitic. 52: 400-401.

32 Smyth, H., Cozzolino, D., Herderich, M.J., Se-fton, M.A.; Francis, I.L. (2005) Relating volatile composition to wine aroma: identifi cation of key aroma compounds in Australian white wines. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of the Twelfth Australian Wine Industry Technical Con-ference, Melbourne, Vic, 24-29 July 2004. Australian Wine Industry Technical Conference Inc., Adelaide SA: 31-33.

33 Sowalsky, R.A.; Noble, A.C. (1998) Comparison of the eff ects of concentration, pH and anion spe-cies on astringency and sourness of organic acids. Chem. Senses 23: 343-349.

34 Swiegers, J.H.; Francis, I.L.; Herderich, M.J.; Pre-torius, I.S. (2006) Meeting consumer expectations through management in the vineyard and winery: the choice of yeast for fermentation off ers great po-tential to adjust the aroma of Sauvignon Blanc wine. Aust. N.Z. Wine Ind. J. 21: 34-42.

35 Torrea, D.; Henschke P.A. (2004) Ammonium su-pplementation of grape juice – eff ect on the aroma profi le of a Chardonnay wine. Tech. Rev. 150, 59-63.

36 Torrea, D.; Siebert, T.; Liebich, B.; Ancin, C.; Fran-cis, L.; Henschke, P.A. (2005) Eff ect of ammonium supplementation of a Chardonnay must on wine aroma. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of the Twelfth Australian Wine Industry Technical Conference, Melbourne, Vic,, 24-29 July 2004. Australian Wine Industry Technical Conferen-ce Inc., Adelaide, SA: 293.

37 Ugliano, M.; Siebert, T.; Capone, D.; Mercurio, M.; Henschke, P.A. (2007) Colour, aroma and fl avour compounds in Shiraz wine as aff ected by DAP addition before fermentation. Blair, R.J.; Williams, P.J.; Pretorius, I. S. (eds.) Proceedings of the thirteen-th Australian Wine Industry Technical Conference, Adelaide, SA, 28 July-2 August 2007. Australian Wine Industry Technical Conference Inc. Adelaide, SA: in press.

38 Vilanova, M.; Ugliano, M.; Siebert, T.; Pretorius, I.J.; Henschke, P.A. (2007) Assimilable nitrogen uti-lization and production of volatile and nonvolatile compounds in chemically defi ned medium by Sa-ccharomyces cerevisiae wine strains. App. Microbiol. Biotechnol. 77: 145-157.

39 Wang, X.D.; Bohlscheid, J.C.; Edwards, C.G. (2003) Fermentative activity and production of volatile compounds by Saccharomyces grown in synthetic grape juice media defi cient in assimilable nitrogen and/or pantothenic acid. J. Appl. Microbiol. 94: 349-359.

Text

os a

soci

ados

71

Seminario Técnico


Unravelling the genetic blueprint of wine yeastBorneman, A.R.; Forgan, A.H.; Chambers, P.J.; and Pre-torius, I.S.


In a world first, scientists at the Australian Wine Re-search Institute have sequenced the wine yeast ge-nome, characterising the ‘recipes of life’ that shape this winemaker’s ‘friend’.

Unlocking the secret to what makes wine yeast tick will put winemakers in a stronger position to use science to their advantage. This work paves the way for the development of new yeast strains, potentia-lly leading to innovative solutions to tackle stuck fermentation and to create wines with desired alco-hol levels and flavour profiles.

Every four years, the Olympic Games inspire the world with spectacular performances and feats of enduran-ce, speed and grace. We marvel at the athletic perfor-mance of the competitors; most of us can only won-der how these champions reach the standards they do. What makes world record-breakers so profoundly different to the rest of us? Are we not the same spe-cies, and therefore shouldn’t we all have the same potential? Couldn’t we also win gold in swimming or running if we had the same training regimes, diet, li-festyle, etc.? The answer is no. Elite athletes are born with a potential that has ‘gold’ stamped all over it. They have muscle-types, physique, physiology and aptitu-de that, with training, can be honed for international success. Unfortunately, most of us would require a great deal more than honing to reach this elite level; until bionics is able to rebuild what we are born with, when it comes to athletics, most humans will have to settle for amateur league or less (Figure 1(a)).

Differences in performance of individuals of the same species are not peculiar to humans; in fact we see it everywhere in nature. Take, for example, the humble yeast that winemakers use to craft complex, delicious wine from sweet, syrupy grape juice. Most wine yeast are the same species, Saccharomyces cere visiae, but not all members of this group are able to produce wine, and, among those that do, there is considerable variation in how reliably and efficiently they work, and in the quality of the wine they produce.

This begs the question: What makes a wine yeast tick? What, in the inner workings of this elite athlete, enables it to grow in such an inhospitable environment and de-

liver gold medal wines when other S. cerevisiae strains don’t even leave the starting blocks? Research at the Australian Wine Research Institute (AWRI) is beginning to unravel the mysteries of the variation across the S. cerevisiae species, and early results on what they tell us about wine yeast are tantalising.

The variation in performance that we see across stra-ins of S. cerevisiae is inheritable; this means that it is genetically determined. The starting point for charac-terising this variation, therefore, should focus on yeast genetics.

Fortunately, S. cerevisiae was the first organism of its type to have its genetic make-up (its genome) sequen-ced, and this was done over ten years ago on a stra-in, known as S288c, chosen for its ‘laboratory friendly’ characteristics (for more information on what genes and genomes are, see the breakout box). Scientists love this yeast because it is very easy to work with, but it would not win any medals in the winemaking arena; in fact, it is probably not even up to amateur status.

Nevertheless, if you want to find out what makes wine yeast so different from other S. cerevisiae strains, you have to have something to compare it with, and S288c is a good starting point.

Another strain of S. cerevisiae, YJM789, recently had its genome sequenced. The genome of this yeast, an opportunistic pathogen isolated from the lungs of an AIDS patient, turned out to be quite different to that S288c. Thus we had two different versions of S. cerevi-siae to compare a wine yeast against, and this is what we found.

It turns out that our wine yeast is a little more different to the two previously sequenced strains than they are to each other (Figure 2). About 0.6% of the letters of the wine yeast sequence are different to what is found in the laboratory strain. This might seem like a small difference, but if you consider that genetic differences between humans and chimpanzees amount to only about 1-2%, it is really quite large.

Perhaps of greater interest, however, is that there are extra DNA sequences in the wine yeast; enough to carry at least 27 genes that are not present in the two yeasts it was compared against. In fact, some of the sequences in this extra DNA do not resemble an-ything found in other species of Saccharomyces; they appear to be more like genes found in very distant fungal relatives. We do not yet know how they got into the wine yeast genome, but we are curious to find out whether or not they play a part in distinguis-hing wine yeast from other S. cerevisiae, particularly in the winemaking stakes.

Some of the wine yeast-specific genes encode pro-teins that are probably associated with the cell wall,

Wine Industry Journal > Vol 23 No 5 > September /October 2008

Text

os a

soci

ados

73

Unravelling the genetic blueprint of wine yeast

a feature of yeast that is undoubtedly important for resilience in inhospitable environments.

We are curious to find out whether these genes im-pact on robustness of wine yeast, a feature that is cru-cial for completing fermentations. Do these genes, for example, make the yeast more or less vulnerable to becoming stuck or sluggish in a ferment? We have also identified genes that probably encode proteins asso-ciated with amino acid uptake (a neutral amino acid transporter) and metabolism (an aspartate transami-nase). Because amino acid metabolism is associated with flavour development, it is tempting to suggest that these genes will impact on sensory attributes in wine, but, of course, this will have to be tested.

Then there are lots of genes that we cannot guess the function(s) of yet, and these might turn out to be the most exciting of all; time and experimental work will tell.

Interestingly, we also found some sizeable rearrange-ments in the genome that we are also curious about,

but cannot even guess what their significance will be.

What does the future hold now that we have this rich source of information on a wine yeast? We will, of course, ascertain as far as possible, which of the uni-que features of a wine yeast genome are important in a winemaking context.

However, we also plan to build on data gathered from this project by sequencing and comparing the genomes of several other wine yeast strains that are known to have different winemaking properties This will enable us to work out what is common to all wine yeasts (i.e. what constitutes the core requirements of a wine yeast) and what differences between them drive production of wines with differing qualities (e.g. different propensities to deliver fruity flavours and aromas).

Once we understand what makes a wine yeast tick, and the significance of variation among wine yeasts, we will be much better placed to develop strains of

Figure 1. No two humans have the same genetic make-up. An elite athlete, for example, is born with a genome that has ‘gold medal’ stamped all over it (Figure 1(a)). Similarly, not all wine yeasts are the

same; different wine yeasts have different genetic make-up (Figure 1(b)). This is why some wine yeast strains are more robust that others and different strains impart different sensory properties to wines.

Understanding what, in the genome of a wine yeast, determines its robustness and its ability to produce desirable (and undesirable) sensory attributes will enable the development of improved strains that will

assist winemakers to craft wines for an increasingly demanding and constantly changing market.

1(a)

1(b)

74

Seminario Técnico


Figure 2. The genome sequences of three strains of Saccharomyces cerevisiae has revealed how similar they are to each other. The numbers in circles on the arrows separating the different

strains represent the number of ‘letters’ in the genome that differ between the strains. The 60,399 differences between a wine yeast and a laboratory

yeast is equivalent to about 0.6% of the genome.

this microorganism that can complete the marathon of fermentation without becoming stuck or sluggish en route, while producing gold medal wines; and all of this should be possible without the need of perfor-mance enhancing additives.

Just like our Olympians at the Australian Institute of Sport, the wine sector has gold-medal aspirations. Backed by sound science and robust research it should be gold all of the way for Australian winemakers.

ACKNOWLEDGEMENTS

The AWRI, a member of the Wine Innovation Cluster in Adelaide, is supported by Australia’s grapegrowers and winemakers through their investment body, the Grape and Wine Research and Development Corpo-ration, with matching funds from the Australian Go-vernment. Systems biology research at the AWRI is performed using resources provided as part of the Na-tional Collaborative Research Infrastructure Strategy, an initiative of the Australian Government, in addition to funds from the South Australian State Government. We gratefully acknowledge the contribution of the Australian Genome Research Facility, a member of Bioplatforms Australia, where the actual sequencing of the wine yeast genome was carried out. We also thank Sharon Mascall and Rae Blair for editorial assis-tance, and JeffEglinton for the preparation of the illus-trations. The detailed results of this work are published in the peer-reviewed journal FEMS Yeast Research.

FURTHER READING

Borneman, A.R, Forgan; A., Chambers, P.J. and Pre-torius, I.S. (2008) Comparative genome analysis of a Saccharomyces cerevisiae wine strain.

FEMS Yeast Research 8:1185-1195.

Borneman, A.R.; Chambers, P.J. and Pretorius, I.S. (2007) Yeast Systems Biology: modelling the winemaker’s art. Trends in Biotechnology 25:349-355.

Goffeau A.; Barrell B.G.; Bussey H.; Davis R.W.; Du-jon B.; Feldmann H.; Galibert F.; Hoheisel J.D.; Jacq C.; Johnston M,; Louis E.J.; Mewes H.W.; Murakami Y.; Philippsen P.; Tettelin H. and Oliver S.G. (1996) Life with 6000 genes. Science 274: 546, 563-567.

Cracking the Code: Genes and Genomes

Genes are recipes for making proteins. For example, your cells carry a gene/recipe for making the protein insulin, which is a hormone that regulates blood sugar level. You also have genes/recipes that instruct your cells how to make proteins that control how tall you can grow, the colour of your eyes, the general shape of your body, etc. It is these recipes of life that dictate whether you will have athletic potential or not, and, because you inherited them from your parents you end up looking like them.

If genes are recipes then genomes are recipe books. The human genome carries all of the recipes required for making proteins to build a human body from conception to adulthood, and repair and defend that body during its life. All of our physiology and anatomy is shaped by a collection of 20,000-25,000 genes that comprise the human genome. And, unless you have an identical twin, your recipe book diff ers a little from everyone else’s.

The language of the genes is very diff erent the languages we use to communicate with each other. It is based on an alphabet of only four letters (A, T, G and C) and its lexicon is limited to three letter words, which means there are only 64 words in the genetic dictionary. However this is more than enough to string together sets of instructions for building all of the proteins (enzymes, hormones, muscles, antibodies, cartilage etc.) we require for life.

The ‘paper’ on which the words that make up the recipes of life is written is known as DNA, and when we read an entire recipe book of an organism, decoding what is recorded in its DNA, we say we are sequencing its genome. What we end up with in this process is a long sequence of millions of A, T, G, and Cs, with no spaces or obvious punctuation marks, that we have to decipher. Thankfully, sophisticated computational aids can do most of this for us.

Text

os a

soci

ados

75

Seminario Técnico


When the heat is on, yeast fermentation runs out of puffCoulter, A.D.; Henschke, P.A.; Simos, C.A. and Pretorius, I.S.


South Australia was sweltering. For more than two weeks in March this year, Adelaide sweated in unre-lenting heat. Thermometers glared red as daytime temperatures refused to drop below 35°C. Scientists called it a record-breaking heatwave: a once in three millennia event. On the vines, sugar levels also soared to record-breaking heights. Varieties that normally mature weeks apart ripened together. Winemakers scrambled to harvest their fruit and crammed their fermentors full. Everyone hoped for the best.

Fermenting a must through to dryness with such high sugar concentrations would have been challenging even for the toughest yeast due to the high levels of ethanol produced. Ferments kicked-offwell but later many started to run out of puffand required robust fer-mentation rescue procedures. Some were still ticking over months later. In the past, the number of queries we receive about stuck fermentations has been fairly constant. This year they doubled.

The Australian Wine Research Institute (AWRI) regu-larly handles calls from winemakers looking for help and advice. But, although the chemistry behind stuck fermentation is simple, the causes are invariably com-plex making them frustratingly difficult to predict. There is evidence that most of the ‘stuck ferment’ que-ries we received were related to the heatwave that hit much of South Australia and Victoria in the first half of March 2008. But stuck fermentation is a complex

problem and research has identified a multitude of potential causes, any combination of which can be involved. Our inability to measure or assess many of these factors in real time further exacerbates the pro-blem. As a result, it can be difficult to work out why it happens.

The definition is straightforward. At some point during fermentation, the process slows or stops too soon, preventing the remaining sugar in the wine from be-ing converted to alcohol and carbon dioxide (Figure 1). Yeast activity – or a lack of it – is usually the culprit. The yeast might be feeling quite stressed due to its environment, or there might be something wrong with the yeast itself, preventing it from doing its job.

Wine yeast works best when the temperature is not too hot, or not too cold and there are plenty of nutri-tious side-dishes to go with the main carbohydrate-rich course. Like any selfrespecting organism, it enjoys sanitary conditions and relative freedom from the irri-tating excesses of unwanted dinner guests (Figure 2) that can spoil the best parties. Coming up for air turns out to be surprisingly important for fermenting yeast – a sniffof oxygen will repay the winemaker many fold with renewed enthusiasm to get back to the job at hand. Inebriating ‘agents’ render it incompetent. Too much ethanol, for example, can stop yeast from growing by starving it of nutrients and increasing the toxicity of other compounds.

The advice from the AWRI is that stuck fermentation is usually avoidable if winemakers keep the basics in ba-lance: moderation of sugar levels, adequate supply of key nutrients including nitrogen and oxygen, effective sulfur dioxide, pH control, avoiding over-clarification, vigilant barrel management and clean conditions from harvester to fermentor. But this year, the heat created a new set of problems.

During March’s heatwave, winemakers reported fruit arriving at the crusher with temperatures in the mid to high 30s. On one particular day, fruit arrived at one wi-nery where temperatures topped 40°C. Some cooling systems could not cope. The scramble to harvest and deliver the rapidly ripening fruit made matters worse.

Inside the wineries, in the fermentors, dehydrated and shrivelled fruit was hard to process, causing blockages in heat exchangers. The first week of the heatwave was bad enough with rapidly rising sugar levels, as has been seen in previous hot vintages. But, the se-cond week stressed the already drought stressed vi-nes beyond their limit producing heavily dehydrated fruit, perhaps as the parched vines deprived sunburnt berries of moisture. Outside, in the trucks queued up with their precious loads, the microbes took hold.

Micro-organisms had a field day in the mountains of warm berries. Delays, lack of refrigeration and the un-

Figure 1. Optimal and sub-optimal fermentation profi les. Four types of sub-optimal fermentation

are commonly observed: delayed on-set; continuously slow ferments; sluggish ferments;

and incomplete or stuck ferments.

% E

than

ol

Time (hr)

Stuck

Sluggish

Slow

Delayed onset

Optimal

0 100 200 300 400

12

8

4

0

24

20

16

12

8

4

0

Alcohol

Biomass

°Brix


Text

os a

soci

ados

77

When the heat is on, yeast fermentation runs out of puff

relenting heat offered an opportunity for growth. The combination of heat stress, dehydration and mechani-cal harvesting had left more fruit damaged than usual. ‘Enemy’ microbes had the perfect breeding ground.

Left to grow unchecked, some ‘bugs’ can wreak havoc. The grape apiculate yeast Hanseniaspora uvarum can develop quickly, for example, robbing grape must of important nutrients. One of its targets is thiamine, for which it has an insatiable appetite. Thiamine is essen-tial for the efficient production of ethanol by Saccha-romyces yeast. There is no easy procedure to detect vitamin deficiencies until the ferment becomes slug-gish and responds to supplements. When excessive growth of wild yeast (Figure 2) is observed between the harvester and fermentor it is important to add thiamine and other vitamins to the starter culture.

For musts from vineyards with a history of fermenta-tion problems, the addition of complex inactivated yeast nutrients can also be beneficial.

Hanseniaspora uvarum can also produce off-flavours including the vinegary taste of acetic acid. Research has shown that hot conditions can dramatically in-crease the production of acetic acid and, this year, wi-nemakers have reported high levels of volatile acidity (VA) to the AWRI.

Lactic acid bacteria also thrive in warm conditions, producing acetic acid as well as other unwanted com-pounds from the grape sugars and acids. Growth of certain lactic acid bacterial strains is enough to leave the pluckiest wine yeast running for cover. Spoilage in addition to stuck fermentation is often the result.

Accumulation of acetic acid beyond a gram per litre starts to affect yeast growth and becomes more toxic as the alcohol level builds.

When this year’s stuck ferments were tested at the AWRI, sensory analysis revealed that a number of them were affected by a mousy off-flavour. They had high concentrations of acetic acid, low concentrations of malic acid – many ferments underwent malolactic fermentation – and they contained various unwelco-me micro-organisms. The results after analysing one red wine with stuck fermentation were typical of tho-se tested (Table 1, see page 27). Lactic acid bacteria are also known to produce mousy off- flavour in grape bins when given a long journey under warm condi-tions without sufficient protective sulfites.

The winemakers’ usual weapons against enemy micro-bes are sulfites, and clarification treatments for whi-tes. But a review of research into stuck fermentation published by the AWRI shows that in extreme condi-tions, adding sulfur dioxide to grape bins might not be enough. Sulfur dioxide has a tendency to ‘hook up’ with sugar, sapping its effectiveness. The high levels of sugar caused by this year’s heatwave would have had such an effect. The higher levels of spoilage noted this year signals that the levels of sulfites normally used to control wild yeast and bacteria was often inadequate under these exceptional conditions.

As a result, winemakers needed to increase their use of sulfites and clean their harvester bins regularly to keep the bugs at bay. Without these kinds of control measures, the development of large populations of indigenous microorganisms could have depleted nu-trients. This would have made it very hard for the wine yeast to complete the fermentation, which with the higher sugar levels would have been an even harder task.

Figure 2. Grapes harbour a variety of yeasts and bacteria, and depending on the addition of sulfi tes, grape temperature and time taken for transport to the winery, the hygienic status of grape processing

machinery, pre-maceration, pressing and clarifi cation procedures, a variable proportion of grape yeasts survive in the juice or must. Together with

microorganisms associated with processing equipment, these yeasts can proliferate in juice or must, depending on physicochemical and nutrient

conditions.

Kluyveromyces

Debaryomyces

Metschnikowia

Schizosaccharomyces

Saccharomycodes

Zygosaccharomyces

Lactic acid bacteria

Dekkera

Candida

Pichia

SaccharomycesAcetic acid

bacteria

HanseniasporaKloeckera

Cryptococcus

Wild yeastSpoilage bacteria

Table 1. Results of analysis of a typical ‘high VA’ 2008 red ferment.

Analysis Result

Alcohol 12.0% v/v

Acetic acid 1.94g/L

Glucose + fructose 47.0g/L

Malic acid <0.05g/L

pH 3.81

Microbiological Yeast: Saccharomyces sp., non-Saccharomyces sp.

Bacteria: Lactobacillus sp. Acetobacter sp.

Sensory Volatile, mousy off-flavour

78

Seminario Técnico


Even when microbes were kept in check, the heat-wave still took its toll. Yeast is particularly sensitive to heat in its growth phase and when temperatures top well over 30°C, in combination with high ethanol, it becomes stressed. When the heat is on, research has shown that the viability and vitality of yeast are affected; it produces more volatile acidity and stuck fermentation is more likely.

High temperatures also increase yeast consumption of nitrogen. If yeast assimilable nitrogen (YAN; Figure 3) is low – due to growth of wild micro-organisms or prevailing drought conditions – then stuck fermenta-tion is also more likely.

The AWRI’s analysis of YAN levels in several hundred juice samples – taken from tanks in two South Aus-tralian wine regions after crushing – show a drop in YAN levels for the 2008 vintage, compared with the previous year (Figure 4(a)).

There were also greater variations between YAN levels in samples taken from the 2008 vintage (Figure 4(b)). This means that some juices would have had relatively low concentrations and the risk of stuck fermentation was more likely.

Various studies have tried to find out how much YAN is needed to reduce the risk of slow or stuck fermen-tations. As a rough guide, the risk increases when YAN levels fall below 140mg N/L in clarified white must of moderate sugar levels, i.e. around 20% (Figure 3). However, since YAN demand increases at high fer-mentation temperatures and when sugar concentra-

tions are high, this threshold increases. More research is needed to determine a threshold for red wine fer-ments.

Recent research at the AWRI is showing that YAN can affect wine style, especially so in white wines. Low YAN ferments tend to give more complex flavour pro-files, sometimes a bit ‘dirtier’, whereas moderate YAN levels give cleaner, fruitier styles in Chardonnay. But this trend is yeast strain and variety dependent. Some yeast strains actually make more H2S at moderate YAN levels compared with low YAN levels; so it is important to know the characteristics of your favourite yeast. Un-til we have better information, it appears that modera-te diamonnium phosphate (DAP) addition may actua-lly reduce the formation of the characteristic tropical fruit thiols in Sauvignon Blanc and related varieties. Using complex inactivated yeast nutrients in this lat-ter case appears to be a better option.

Research has also shown that agrochemicals might also have played a role in the increased incidence of stuck fermentations. While residues of copper from fungicides, are unlikely to cause problems on their own, they might frustrate fermentation when other factors come into play. Late application of agrochemi-cals to fruit that was harvested weeks ahead of sche-dule, together with the dry conditions, could have contributed to slightly higher residue levels.

One favourite suspect – often held responsible for stuck fermentation by winemakers – is not proven guilty, however, by AWRI research. Every year, the AWRI handles enquiries about glucose-to-fructose ratios, as winemakers suspect that fructose is somehow to blame when fermentation grinds to a halt. Research has shown, and indeed has been known for nearly a century, for example, that the Saccharomyces yeast tends to consume glucose more quickly than fructose and that the last few grams of sugar feeding the final stages of fermentation will be fructose. Under ‘nor-mal’ circumstances, when there are no other factors affecting fermentation, the yeast will use the fructose. But as far as the AWRI is aware, there is no conclusive evidence that higher amounts of fructose will cause stuck fermentation. Until proven otherwise, it appears that the high fructose:glucose ratio is a symptom ra-ther than cause of stuck fermentation.

Sluggish and stuck ferments from the 2008 vintage are characterised by higher residual sugar concentrations than usual. Under these tougher conditions more robust rescue procedures are needed. By all reports, the AWRI’s acclimatisation procedure is working well and has benefited from several improvements, such as fining musts with yeast hulls and racking offyeast lees before reinoculation, and rehydrating the initial yeast preparation with complex yeast nutrients. The important principal behind this procedure is that the rescue culture is sequentially acclimatised to the high

Figure 3. The risk of fermentation problems is increased when grape must is sub-optimal in nutrient content, especially for assimilable

nitrogen, and vitamins, the latter of which can be lost during grape harvest and must processing. A high ratio of sugar to other nutrients can lead to low biomass and fermentation rate, and the

early onset of sugar transport inactivation in yeast. The general rule of thumb is that musts with YAN

levels of <150mg/L are more likely to result in slow fermentations, and musts with <50mg/L are more likely to result in stuck ferments (see also

Figure 1).

Initial YAN (mg/L)

Stuck

Slow

Optimal

Gluc

ose

(g/L

)

Time (hr)

0 40 80 120 160 200

200

160

120

80

40

0

25

50

100150250400

Text

os a

soci

ados

79

When the heat is on, yeast fermentation runs out of puff

concentrations of inhibitors in the stuck wine, espe-cially ethanol. It is, however, critically important that the yeast not be starved of sugar or nitrogen during the stepwise acclimatisation procedure. The culture should also be briefly aerated at each step.

Fresh yeast lees from successfully completed ferments can also be useful for reinvigorating or restarting fer-ments when a relatively small amount of residual su-gar remains. A small addition of DAP and limited aera-tion, once the yeast is actively fermenting, promotes good activity. This procedure provides a more conve-nient rescue option when yeast lees are available.

Looking ahead, the AWRI is also alerting winemakers to the longer term effects of the 2008 heatwave. If red wines contain higher than usual amounts of residual

• Increase the concentration of sulfur dioxide added to grape bins. Th is will keep micro-bial ‘bugs’ at bay and slow oxidation which can speed up at higher temperatures.

• Sanitise bins between loads. Cover bins during transport to keep the sun off fruit. Clean all equipment to stop bacteria.

• Choose yeast known to have high tolerance to alcohol and prepare it properly. Rehydra-tion of dried yeast with complex inactiva-ted yeast nutrients can be benefi cial for stressful ferments.

• Dilute very high sugar musts with low strength juice (LSJ) before fermentation to improve wine balance, in accordance with wine statutory regulations.

• Add tartaric acid as soon as must tanks are mixed and acidity levels are known. Check again after thorough mixing to ensure le-vels are correct.

• Take steps to reduce pH to improve the effi cacy of sulfur dioxide. Lower pH increases its antimicrobial and antioxidant proper-ties. It controls the growth of unwanted microorganisms including lactobacilli, some species of which are known to inhibit yeast development.

• Monitor pH during fermentation and main-tain it between 3.4-3.5.

• Measure YAN, preferably on the last vine-yard maturity sample before harvest, so that DAP can be added accordingly. If this

is not possible, add DAP as a precaution against low YAN, especially in dry years and when sugar concentrations are high, since more YAN is needed by yeast to achieve low residual sugars.

• Aeration of ferments around the mid point of fermentation can be highly benefi cial by restoring lagging rates and has no known adverse impact on wine fl avour, rather it can prevent quality losses which someti-mes result from stuck fermentations.

• Increasing juice turbidity consistent with target wine style can considerably improve growth and fermentation activity.

• Consider adding lysozyme to must of fer-ments to control bacterial development.

0

50

100

150

200

250

Region B

2007 2008

YAN

conc

entra

tion

(mg/

L)

0

20

40

60

80

100

120

Region ARegion A Region B

YAN

conc

entra

tion

SD (m

g/L)

4(a) 4(b)

Figure 4(a). The average YAN concentration in juices from two regions in South Australia for the 2007 vintage and the 2008 vintage. For region A, n = 855 in 2007 and 1272 in 2008; for region B, n = 414 in 2007 and 788 in 2008. Figure 4(b). Standard deviation in average YAN concentration from wine regions A and B

was greater in 2008 than in 2007.

sugar, and other nutrients added as fermentation stimulants, for example, the Brettanomyces/Dekkera yeast, can strike later in the maturation cycle or even after bottling of unfiltered wines. The higher alcohol concentrations of 2008 wines might slow the growth of this spoiler meaning that greater vigilance should be maintained further on down the process chain. Malolactic fermentation is also adversely affected by high alcohol levels such that Brettanomyces/Dekkera yeast can have a greater opportunity while the wine is unprotected by sulfites. The more alcohol tolerant lactobacilli, which are capable of forming biogenic amines, will also thrive if the pH is not maintained be-low 3.5, which is more favourable to Oenococcus. The impact of March 2008 might continue if not managed with greater care due to the perturbed nature of this year’s wine chemistry.

Stuck fermentations – what you can do

80

Seminario Técnico


• The 2008 vintage in southern Australia experienced an increase in cases of stuck fermentation.

• The March heatwave was a key factor. Yeast does not thrive in ex-treme heat or cold, or indeed when subjected to rapid changes in temperature.

• Heat stress, transport delays and refrigeration problems gave unwanted microbes a head start, further compromising yeast ac-tivity.

• High sugar levels led to high amounts of ethanol, which can be toxic to yeast, leading to higher residual sugar levels in wine. Higher nutrients can stimulate Brettanomyces/Dekkera yeast during ma-turation.

• Low YAN levels after persistent drought also had an impact.• Simple strategies such as keeping bins and equipment clean, mo-

nitoring pH and using the right yeast and nutrients, can give wine-makers the upper hand.

ACKNOWLEDGEMENTS

The Australian Wine Research Institute, a member of the Wine Innovation Cluster in Adelaide, is supported by Australia’s grapegrowers and winemakers through their investment body, the Grape and Wine Research and Development Corporation, with matching funds from the Australian Government. We thank Sharon Mascall and Rae Blair for editorial assistance, and Je-ffEglinton for the preparation of illustrations.

FURTHER READING

Bell, S.J. and Henschke, P.A. (2005) Implications of nitrogen management for grapes and wine. Austra-lian Journal of Grape and Wine Research 11:242-295.

Bisson, L.F. and Butzke, C.E. (2000) Diagnosis and rectification of stuck and sluggish fermentations. American Journal of Enology and Viticulture 51:168-177.

Bisson, L.F. (1999) Stuck and sluggish fermentations. American Journal of Enology and Viticulture 50:107-119.

Eglinton, J.M. and Henschke, P.A. (1999) Restarting incomplete fermentations: the effect of high concen-trations of acetic acid. Australian Journal of Grape and Wine Research. 5:71-78.

Henschke, P.A. (1997) Stuck fermentation: causes, prevention and cure. Allen, M.; Leske, P.; Baldwin, G., eds. Advances in juice clarification and yeast inocula-tion: proceedings of a seminar; 15 August 1996; Mel-bourne, Victoria. Adelaide, South Australia: Australian Society of Viticulture and Oenology; 1997: 30-38, 41.

Sablayrolles, J.M.; Dubois, C.; Manginot, C.; Rous-tan, J.L. and Barre, P. (1996) Effectiveness of combi-ned ammoniacal nitrogen and oxygen additions for completion of sluggish and stuck fermentations. Jour-nal of Fermentation and Bioengineering 82:377-381.

Schmidt, S.A.; Tran, T.; Chambers, P.J.; Herderich, M.J. and Pretorius, I.S. (2006) Developing indicators of wine yeast performance: an overview of the impact of ethanol stress. Australian and New Zealand Wine Industry Journal 21:24-30.

Ugliano, M.; Henschke, P.A.; Herderich, M.J. and Pretorius, I.S. (2007) Nitrogen management is criti-cal for wine flavour and style. Australian and New Zea-land Wine Industry Journal 22:24-30.

These articles can be obtained by contacting the AWRI’s John Fornachon Memorial Library.

Email [email protected], telephone (08) 8303 6600.

Further information is also available on the AWRI’s we-bsite www.awri.com.au A summary of factors affecting sub-optimal fermentation is presented by Dr Paul Hens-chke in a webcast at www.awri.com.au.

This site is accessible to all Australian grape and wine levy payers.

Summary

Text

os a

soci

ados

81

Seminario Técnico


Taking control of alcoholVarela, C.; Kutyna, D.; Henschke, P.A.; Chambers, P.J.; Herderich, M.J.; Pretorius, I.S.


Alcohol is the backbone of wine, yet too much can put a wine off-balance. Taking control of alcohol le-vels in wine is, therefore, critical to the winemaker’s art; can winemakers bottle the sunshine flavours we expect of Australian wine but leave out some of the alcohol? One of the keys is wine yeast. Previously chosen for their efficiency in converting sunshine into alcohol, we are now generating new strains of yeast that make reduced levels of alcohol; still lots of sunshine in the bottle but with less risk of ‘sun-burn’.

Getting the alcohol level right in winemaking can be surprisingly difficult. This is particularly evident when grapes are grown where the weather is warm and fruit is given lots of time on the vine for flavour develop-ment; in these conditions ‘high alcohol’ can become a problem.

Over the past 20 years, the Australian Wine Research Institute has charted an increase in average alcohol le-vels in Australian wine. In 1984, levels were 12.4% v/v; in 2004, they had risen to 14.2% v/v, and similar stories are heard from around the grapegrowing regions of the world. The 2008 vintage hit another ‘sugar high’ as the heatwave across southern Australia midway through harvest took its toll.

Hot weather accelerates ripening, which leads to hig-her levels of sugar. Higher amounts of sugar lead to higher levels of alcohol. In countries like ours, where the sun shines for long hours and some grapes are left on the vine to create rich, full-bodied flavours, high alcohol is becoming an issue.

Wine with high alcohol levels can mean higher costs. In countries where taxes are levied according to etha-nol content, high alcohol wines can be taxed out of the market. High alcohol can also compromise flavour, and today’s society is seeking a healthier approach to high alcohol consumption.

To tackle the problem, the Australian wine sector is investigating new ways to lower the concentration of ethanol in wine. One strategy is to harvest grapes be-fore they reach full maturity, when the concentration of sugar in the berries is lower. To a degree, this appro-ach is already being used by some winemakers. But, until we understand viticultural factors that advance

flavour development in relation to sugar ripeness, this approach can undermine the full-bodied charac-ter and ripe fruit flavours for which some Australian wines are known. Removing sugar from grape must before fermentation is another way to lower ethanol but is relatively expensive to carry out. A third strategy used successfully at a number of wineries around the world is to remove alcohol from wine after fermenta-tion. Even this has its drawbacks: it adds to production costs; might impact wine flavour under certain condi-tions, and not all international markets might accept Australian wine that has undergone this procedure.

Another strategy is to target wine yeast. The hunt is on for strains of wine yeast that convert less of the sugar they consume into ethanol (see, for example, Figure 1). Commercially available Saccharomyces cerevisiae strains have been categorised by some yeast manu-facturers according to the concentrations of ethanol they produce.

But how different are these yeasts? Do strains really di-ffer in terms of the ethanol they produce? To find out, scientists at the AWRI checked how much ethanol is produced by six commercial wine yeasts described by manufacturers as low- or high-ethanol strains.

We also investigated two of our own novel wine yeasts – produced at the AWRI – to see how efficient they were at fermentation and how much ethanol they produced. The two strains came from early stage experimental work at the AWRI aimed at generating yeast that produce reduced amounts of ethanol.

A

Grape sugars:

Glucose

Fructose

Ethanol

C0 2

Glycerol

B

Grape sugars:

Glucose

Fructose

Ethanol

Figure 1. Sugar metabolism of wine yeast. A: Consumption of sugars leads mainly to the

production of ethanol and carbon dioxide and, to a lesser extent, glycerol. B: Modifying yeast metabolism so more glycerol is synthesised

reduces the amount of ethanol produced.


Text

os a

soci

ados

83

Taking control of alcohol

We tested the eight different yeasts using chemically defined grape juice (CDGJ), containing specified le-vels of sugar and yeast assimilable nitrogen, and Char-donnay juice. Fermentation took place in controlled laboratory conditions and, once complete, samples were collected for analysis. The researchers measured residual sugar, ethanol, glycerol, malic acid and acetic

acid as well as alcohol in the synthetic wine (CDGJ) and Chardonnay using advanced analysis techniques.

The concentrations of ethanol produced by the six commercial wine strains are shown in Figure 2. In syn-thetic wine, ethanol concentrations varied between 11.3% v/v and 11.6% v/v with a maximum difference of 0.3% v/v. In Chardonnay, ethanol content varied between 12.4% v/v and 12.9% v/v, with a maximum difference of 0.5% v/v. The differences look small but are statistically significant. They are also supported by a previous research study that tested 113 strains of wine yeast grown in synthetic grape juice.

Although there are no published data on final ethanol concentrations in red varieties, our research shows it is very likely that 0.5% v/v is the maximum difference possible by choosing a currently available, commer-cial wine yeast strain. Commercial strains do not give rise to large differences in ethanol concentrations. As a result, we are trying to generate novel strains of wine yeast that metabolise sugar in such a way that less ethanol is produced while maintaining high wine quality.

Using a non-genetically modified (non-GM) appro-ach, known as adaptive evolution, we are working to create the right conditions to ‘persuade’ yeast to produce less ethanol. Even though the science is not straightforward, early results have been promising.

So far, two prototype yeast strains have been produ-ced – AWRI 1689 and AWRI 1690. Both generate less ethanol than their parent strain – N96 (similar to stra-

Figure 2. Ethanol content of wine produced from chemically defined grape juice (CDGJ)

and Chardonnay juice, fermented with different commercial wine yeast strains.

CDGJ12.0 –

11.5 –

11.0 –

10.5 –

10.0 –

13.5 –

13.0 –

12.5 –

12.0 –

11.5 –

11.0 –

10.5 –

AWRI 796 Maurivin B A WRI R2 PDM UCD522 N96 AWRI 1689 AWRI 1690

AWRI 796 Maurivin B A WRI R2 PDM UCD522 N96 AWRI 1689 AWRI 1690

Chardonnay

Etha

nol [

% v

/v]

Etha

nol [

% v

/v]

Table 1. Product concentrations in wine made from Chardonnay juice using N96 and wine yeast variants obtained by adaptive evolution.

Strain Ethanol [% v/v] Glycerol [g/L] Acetic acid [g/L] Fermentation

efficiency* [g sugar per 1% ethanol]

N96 12.9 ± 0.1 5.8 ± 0.1 0.1 ± 0.0 16.1 ± 0.1

AWRI 1689 12.7 ± 0.1 7.0 ± 0.0 0.1 ± 0.0 16.4 ± 0.1

AWRI 1690 12.6 ± 0.1 7.1 ± 0.0 0.0 ± 0.0 16.5 ± 0.1

* Initial and residual sugar concentrations were used to calculate fermentation efficiency.

Table 2. Product concentrations in wine made from Chardonnay juice using a range of different commercial wine yeast strains.

Strain Ethanol [% v/v] Glycerol [g/L] Acetic acid [g/L] Fermentation

efficiency* [g sugar per 1% ethanol]

AWRI 796 12.4 ± 0.1 7.7 ± 0.2 0.1 ± 0.0 16.8 ± 0.2

Maurivin B 12.7 ± 0.1 6.4 ± 0.0 0.5 ± 0.0 16.5 ± 0.1

AWRI R2 12.7 ± 0.1 6.4 ± 0.0 0.1 ± 0.0 16.4 ± 0.1

PDM 12.8 ± 0.1 5.9 ± 0.1 0.2 ± 0.0 16.3 ± 0.1

UCD 522 12.8 ± 0.0 6.3 ± 0.1 0.1 ± 0.0 16.2 ± 0.0

N96 12.9 ± 0.1 5.8 ± 0.1 0.1 ± 0.0 16.1 ± 0.1

* initial and residual sugar concentrations were used to calculate fermentation efficiency.

84

Seminario Técnico


ins known in the industry as EC1118, Pris de Mousse and PDM) – but were still fast at fermentation. The two new strains metabolised a small portion of sugar in such a way that it did not turn into ethanol (Table 1).

It was also important to investigate other metabolites, since major distortions in their concentrations might affect aroma or flavour. Table 2 shows glycerol and acetic acid concentrations in Chardonnay wines, fer-mented using commercial wine yeast strains. For all strains, there was clearly a link between ethanol and glycerol concentrations. Higher glycerol was associa-ted with lower ethanol. The major component of vo-latile acidity, acetic acid, was not affected.

The decrease in ethanol concentration might be small compared with the two ‘lowered ethanol’ prototype yeast strains produced by the AWRI, but we are confi-dent our ‘non-GM’ strategy is working.

The AWRI’s technology should be capable of ge-nerating strains that are even lower in ethanol than those currently available. For winemakers wanting to take control of high alcohol, innovation is driving the evolution of wine yeast in the right direction. Nature took some 20 million years to evolve highly efficient fermentation yeast, we hope to reverse some of this evolution in a relative blink of the eye!

ACKNOWLEDGEMENTS

The Australian Wine Research Institute, a member of the Wine Innovation Cluster in Adelaide, is supported by Australia’s grapegrowers and winemakers through their investment body, the Grape and Wine Research and Development Corporation, with matching funds from the Australian Government.

The authors wish to thank Rae Blair and Sharon Mas-call for editorial assistance.

FURTHER READING

De Barros Lopes, M.; Eglinton, J.M.; Henschke, P.A.; Høj, P.B. and Pretorius, I.S. (2003) The connection between yeast and alcohol production in wine: Ma-naging the double edged sword of bottled sunshine. Australian and New Zealand Wine Industry Journal 18:27-31.

Godden, P.W. and Gishen, M. (2005) Trends in the composition of Australian wine 1984-2004. In: Blair, R.J.; Francis, M.E. and Pretorius, I.S. (ed) Advances in wine science – commemorating 50 years of The Aus-tralian Wine Research Institute, The Australian Wine Research Institute, pp115-139.

Guth, H. and Seis, A. (2002) Flavour of wines: towards an understanding by reconstitution experiments and an analysis of ethanol’s effect on odour activity of key compounds. Blair, R.J.; Williams, P.J. and Høj, P.B., (eds). In: Proceedings of the eleventh Australian Wine Indus-try Technical Conference; 7-10 October 2001. Adelai-de, SA Australian, Australian Wine Industry Technical Conference Inc.; pp128-139.

Jenson, I. (1997) Differences in alcohol production by various yeast strains: myth or fact? Allen, M.; Leske, P. and Baldwin, G. (eds.) Advances in juice clarification and yeast inoculation: Proceedings of a seminar; 15 August 1996; Melbourne, Vic. Adelaide, SA: Australian Society of Viticulture and Oenology; pp24-25.

Palacios, A.; Raginel, F. and Ortiz-Julien, A. (2007) Can the selection of Saccharomyces cerevisiae yeast lead to variations in the final alcohol degree of wines? Australian and New Zealand Grapegrower and Wine-maker 527, 71-75.

Piskur, J.; Rozpedowska, E.; Polakova, S.; Merico, A. and Compagno, C. (2006) How did Saccharomyces evolve to become a good brewer? Trends in Genetics 22, 183-186.

• Hot weather and mature fruit make high alcohol levels in wine more likely.• The 2008 vintage is set to hit a ‘sugar high’, with high levels of ethanol.• Winemakers want to keep alcohol under control for cost, taste and health reasons.• Scientists at the AWRI have pioneered a new, GM-free approach to ‘persuade’ yeast to produce less ethanol during fermentation.• Studies have shown that the maximum variation in ethanol levels from current, commercial yeast strains is 0.5% v/v.• Innovation at the AWRI is driving the evolution of new, ‘low ethanol’ yeast in the right direction.

Summary

Text

os a

soci

ados

85

Seminario Técnico


A la recerca del codi digital dels llevats del viBorneman, A.R.; Forgan, A.H.; Chambers, P.J. i Pretorius, I.S.

The Australian Wine Research Institute, Glen Osmond (Adelaida), Australia.

Per primera vegada, científics del Australian Wine Research Institute han seqüenciat el genoma d’un llevat del vi, caracteritzant la «recepta de la vida» d’aquest microorganisme amic de l’enòleg. Un camí obert al desenvolupament de noves soques que pu-guin contribuir amb solucions innovadores al pro-blema de les parades fermentatives i a augmentar les opcions de l’enòleg.

Cada quatre anys, els Jocs Olím-pics inspiren al món amb actua-cions espectaculars i proeses de resistència, velocitat i elegància. Ens sorprenem davant les fites atlètiques dels competidors i la majoria de nosaltres només po-dem preguntar-nos com aconse-gueixen aquests campions arribar a aquests estàndards de somni. Què fa a aquests guanyadors tan diferents de la resta de persones? No som la mateixa espècie, i per tant, no hauríem de tenir tots el mateix potencial? No podríem, també nosaltres, guanyar una medalla d’or en natació o atletisme si comptéssim amb el mateix entrenament, dieta i estil de vida?

La resposta és negativa. Els atletes d’elit neixen amb un potencial que porta el segell de l’«or» ja estampat. Tenen el tipus de fibres musculars, el físic, la fisiologia i les aptituds que, amb entrenament adequat, poden arribar a ser perfeccionats per a l’èxit internacional. La-mentablement, la majoria de nosaltres requeriríem de molt més que aquest afinament per assolir aquest ni-vell; fins que la biònica ens permeti substituir allò amb el que vam néixer, quan parlem d’atletisme, la majoria de nosaltres ens haurem de conformar amb participar en una lliga amateur o, fins i tot, menys.

La variació individual

Aquestes diferències en el rendiment dels individus d’una mateixa espècie no són tan sols exclusives de l’ésser humà. De fet, podem apreciar- les contínua-ment a la natura. Prenem, per exemple, l’humil llevat que els enòlegs utilitzen per produir el complex i irre-

sistible vi a partir del most del raïm. La majoria dels lle-vats del vi són de la mateixa espècie, Saccharomyces cerevisiae, però no tots els membres d’aquest grup són capaços de produir vi i, entre aquelles soques que ho són, hi ha una considerable variació de com d’eficients són i com fidedignament fan la seva feina i com poden produir vins de qualitat.

Això ens porta a la següent pregunta: Què marca a un llevat del vi? Què existeix en el funcionament intern d’aquest atleta d’elit, que li permet créixer en un am-bient tan hostil i aconseguir vins amb medalles d’or mentre altres soques de S. cerevisiae no passen de la línia de sortida? Estudis portats a terme a l’Australian Wine Research Institute (AWRI) comencen a desvetllar misteris de les variacions entre soques de S. cerevi-siae, essent els primers resultats obtinguts realment prometedors.

La variació en el rendiment que observem entre so-ques de S. cerevisiae és un atribut heretable; això

significa que està genèticament determinat. Per tant, el punt de partida per caracteritzar aquesta variació s’hauria d’enfocar priori-tàriament en la genètica dels lle-vats. Sortosament, S. cerevisiae va ser el primer organisme del seu tipus en tenir el seu genoma se-qüenciat. Això va assolirse fa uns deu anys en una soca coneguda com S288c, escollida per la seva idoneïtat a les condicions del la-boratori (per una informació més detallada sobre què són els gens

i els genomes, consulteu requadre). Als científics els encanta aquest llevat ja que és molt fàcil treballar amb ell, però d’altra banda, no seria una soca capaç de guanyar cap medalla en el camp de la producció de vi, de fet, és possible que ni tan sols arribi a nivells dels que en diríem «amateurs ». No obstant, per discernir què és el que fa un llevat del vi tan diferent d’altres soques de S. cerevisiae és necessari disposar d’alguna cosa amb qui comparar-la, i S288c és un bon punt de partida.

El genoma d’una altra soca de S. cerevisiae, YJM789, s’ha seqüenciat recentment. El genoma d’aquest lle-vat, un patogen oportunista aïllat dels pulmons d’un pacient amb SIDA, va resultar força diferent al d’S288c. Així, ara disposem de dues versions diferents de S. ce-revisiae amb les que poder comparar el llevat del vi, i això va ser el que vam trobar.

L’especificitat genètica del llevat del vi

El nostre llevat del vi presenta més diferències amb les dues soques prèviament seqüenciades, que les que presenten aquelles dues entre elles. Prop del 0,6

Algunes de les seqüències de DNA addicional trobades

en el llevat del vi, no s’assemblen a res trobat en

d’altres espècies de Saccharomyces

ACE Revista d’Enologia 4rt Trimestre 2008

Text

os a

soci

ados

87

A la recerca del codi digital dels llevats del vi

% de les lletres genètiques de la seqüència del llevat del vi són diferents de les de la soca de laboratori. Això pot semblar una molt petita diferència, però si consi-derem que la distància genètica entre dues espècies com els humans i els ximpanzés és únicament d’un 1-2 %, el 0,6 % seria una xifra força considerable per a dues soques d’una mateixa espècie.

D’altra banda, potser el que sigui més interessant d’aquests resultats, és que s’han trobat seqüències addicionals al llevat del vi, que són suficients per afe-gir com a mínim 27 gens que no estan presents en les soques de Saccharomyces amb que va ser compara-da. De fet, algunes de les seqüèn-cies en aquest DNA addicional no s’assemblen a res trobat en d’altres espècies de Saccharomyces. De fet, aquestes seqüències són més similars a gens trobats en fongs força llunyans filogenèticament. Encara no sabem com van arribar al genoma del llevat del vi, però tenim una certa curiositat per ava-luar si aquestes seqüències estan involucrades en la diferenciació entre llevats del vi i altres S. cerevi-siae, especialment en allò referent a les característiques necessàries per produir vi.

Alguns dels gens específics en el llevat del vi codi-fiquen, probablement, proteïnes associades amb la paret cel·lular, un tret del llevat que és, sense cap mena de dubte, important per a la seva resistència en ambients inhòspits. Ens agradaria descobrir si aquests gens tenen alguna mena d’impacte en la robustesa del

llevat del vi, una característica que és de gran impor-tància per completar la fermentació. Ens preguntem, per exemple, si aquests gens fan al llevat del vi, més o menys vulnerable a fermentacions lentes o a parades fermentatives. També hem identificat gens que pro-bablement codifiquen proteïnes associades amb la captura d’aminoàcids (un transportador d’aminoàcids neutre) i el seu metabolisme (una aspartat transami-nasa). Pel fet que el metabolisme d’aminoàcids està directament relacionat amb el desenvolupament de compostos associats a sabor i aroma, és temptador su-ggerir que aquests gens podrien tenir un impacte en els atributs sensorials del vi, encara que això s’hauria

d’investigar i confirmar.

A més a més, existeixen multitud gens dels quals encara no podem inferir les seves funcions. Aquests podrien resultar ser els més inte-ressants de tots; el temps i el tre-ball experimental ens ho diran.

De manera molt interessant, també hem trobat alguns reor-denaments cromosòmics en el genoma d’aquest llevat i sobre els quals també estem intrigats,

encara que de moment no podem fer-nos una idea de quina serà la seva veritable importància i abast.

El que fa a un llevat del vi

Què ens portarà el futur a partir d’ara que ja dispo-sem d’aquesta enorme font d’informació sobre un lle-

Desxifrant el codi: gens i genomes

Els gens són receptes per fabricar proteïnes. Per exemple, les cèl·lules del lector posseeixen un gen o recepta per fer la proteïna insulina, que és una hormona que regula els nivells de sucre en sang. També tenim gens o receptes que instrueixen a les nostres cèl·lules sobre com fer proteïnes que controlen l’estatura fins la que creixerem, el color dels nostres ulls, la forma general del nostre cos, etc. Són aquestes mateixes receptes de la vida les que dicten si disposarem de potencial atlètic o no i, degut a que les heretem dels nostres

pares, acabarem semblant-nos a ells. Si els gens són receptes, llavors els genomes són llibres de receptes. El genoma humà disposa de totes les receptes necessàries per fabricar les proteïnes que es requereixen per construir un cos humà, des del moment de la concepció fins la maduresa, i per reparar i defensar aquest cos durant tota la vida. Tota aquesta fisiologia i anatomia estan modelades per una col·lecció de 20 000 – 25 000 gens que s’estenen pel genoma humà. Excepte en el cas de tenir un bessó idèntic, el nostre llibre de receptes és diferent del que tenen la resta dels nostres congèneres.

El llenguatge dels gens és molt diferent dels llen- guatges que fem servir habitualment per comunicar-nos els uns amb els altres. Està basat en un alfabet de tan sòls quatre lletres (A, T, G i C), i el seu lèxic està limitat a paraules amb tres lletres, fet que significa que només existeixen 64 paraules en el diccionari genètic. Tot i el que semblaria a primer cop d’ull, això és més que suficient per elaborar tot el conjunt d’instruccions que permeten construir totes les proteïnes (enzims, hormones, anticossos, cartílags, etc.) que requerim per a la vida.

El paper en que les paraules que configures les receptes de la vida esta escrites es coneix com DNA, i quan nosaltres llegim el llibre de receptes complet d’un organisme, desxifrant el que està gravat al DNA, diem que estem seqüenciant el seu genoma. El que acabem tenint en aquest procés és una llarga seqüència de milions de lletres A, T, C i G, sense espais o signes de puntuació evi-dents, i que hem de desxifrar. Afortunadament, disposem de programes informàtics que poden fer la major part d’aquesta feina per nosaltres.

En el futur, serem capaços d’esbrinar

quins d’aquests trets únics del genoma

d’un llevat del vi són determinants en

l’àmbit de la producció vinícola

88

Seminario Técnico


vat del vi? Per suposat, serem capaços de determinar quins d’aquests trets únics del genoma d’un llevat del vi són determinants en l’àmbit de la producció de vi. Tot i això, també ens plantegem acumular més dades a partir d’aquest projecte mitjançant la seqüenciació i comparació dels genomes d’altres llevats del vi, aque-lles que posseeixen diferents propietats per la seva capacitat per produir vi. Això ens permetrà determi-nar què és comú a tots els llevats del vi (per exemple, quins són els requeriments fonamentals d’un llevat del vi) i quines diferències entre elles condueixen a la producció de vins amb diferents qualitats (per exem-ple, la predisposició a produir uns determinats aromes i matisos frutals).

Un cop puguem entendre que és allò que determi-na el destí d’un llevat del vi, i el significat profund d’aquestes variacions entre soques de llevats del vi, estarem en una millor posició per desenvolupar va-riants d’aquest microorganisme que puguin com-pletar la marató de la fermentació sense alentir-la o evitant quedar parades durant el seu curs, produint al mateix temps vins mereixedors d’una medalla d’or; i tot això seria possible sense afegir additius que incre-mentin el rendiment.

De manera similar als nostres esportistes olímpics, el sector del vi també ha de tenir aspiracions a medalles d’or. Amb el suport d’una ciència de qualitat i una re-cerca robusta, haurien de ser tot ors per als productors de vi.

Agraïments

Els membres de l’equip del AWRI responsables de dis-cernir el mapa genètic del llevat del vi són els doctors Anthony Borneman, Angus Forgan, Paul Chambers i Sakkie Pretorius.

L’Australian Wine Research Institute, un dels membres del Wine Innovation Cluster a Adelaida, disposa del suport econòmic dels productors de raïm i de vi a tra-vés del seu organisme d’inversió, el Grape and Wine

Els membres de l’equip investigador australià. D’esquerra a dreta: Paul Chambers, Angus Forgan, Sakkie Pretorius i Anthony Borneman.

Research and Development Corporation, a més d’una subvenció equivalent del Govern australià.

La recerca en l’àrea de la biologia de sistemes al AWRI es realitza amb recursos provinents en part del Natio-nal Collaborative Research Infrastructure Strategy, una iniciativa del Govern australià, amb fons addicionals del Govern de l’Estat de South Australia. Agraïm tam-bé la contribució de la Australian Genome Research Facility, membre de Bioplatforms Australia, on es va portar a terme la seqüenciació del genoma del llevat del vi. També volem agrair a Sharon Mascall i Rae Blair per l’ajut en la redacció, i a Jeff Eglinton per la prepara-ció de les il·lustracions. Els resultats científics detallats d’aquest treball han estat publicats a la revista FEMS Yeast Research.

Bibliografia Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius, I.S.: «Comparative genome analysis of a Saccharomy-ces cerevisiae wine strain», FEMS Yeast Research 2008; 8: 1185-1195.

Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius, I.S.: «Unravelling the genetic blueprint of wine yeast», Australian and New Zealand Wine Industry Journal 2008; 23: 21-23.

Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius, I.S.: «Cracking the genetic code of wine yeast», Wine Business Monthly 2008, octubre: 41-43.

Borneman, A.R.; Chambers, P.J.; Pretorius, I.S.: «Yeast Systems Biology: modelling the winemaker’s art», Trends in Biotechnology 2007; 25: 349-355.

Goffeau, A.; Barrell, B.G.; Bussey, H.; Davis, R.W.; Du-jon, B.; Feldmann, H.; Galibert, F.; Hoheisel, J.D.; Jacq, C.; Johnston, M.; Louis, E.J.; Mewes, H.W.; Murakami, Y.; Philippsen, P.; Tettelin, H.; Oliver, S.G.: «Life with 6000 genes»,

Text

os a

soci

ados

89

Seminario Técnico


Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contents

Cano-López, M.; Pardo-Mínguez, F.; Schmauch, G.; Saucier, C.; Teissedre, P.L.; López-Roca, J.M.; and Gómez-Plaza, E.

Departamento de Tecnología de Alimentos, Nutrición y Bromatología, Facultad de Veterinaria, Universidad de Murcia, Spain, Bodegas San Isidro, Jumilla, Murcia, Spain, and Faculté d’Oenologie, Université Victor Segalen, Bordeaux 2, France

Several factors may affect the results obtained when micro-oxygenation is applied to red wines, the most important being the moment of application, the do-ses of oxygen, and the wine phenolic characteristics. In this study, three red wines, made from Vitis vinifera var. Monastrell (2005 vintage) and with different phe-nolic characteristics, were micro-oxygenated to deter-mine as to how this technique affected the formation of new pigments in the wines and their chromatic characteristics. The results indicated that the different wines were differently affected by micro-oxygenation. In general, the micro-oxygenated wines had a higher percentage of new anthocyanin-derived pigments, being that this formation is more favored in the wines with the highest total phenol content. These com-pounds, in turn, significantly increased the wine color intensity. The wine with the lowest phenolic content was less influenced by micro-oxygenation, and the observed evolution in the degree of polymerization of tannins suggested that it might have suffered ove-roxygenation.

KEYWORDS: Wine; color; anthocyanins; anthocya-nin-derived compounds; micro-oxygenation.

INTRODUCTION

Phenolic compounds are responsible for many of the organoleptic characteristics of wines. Among them, anthocyanins are responsible for the color of red wine,

while their interactions with other compounds largely determine the color changes observed in maturing wines. The wine phenolic content depends on the grape characteristics and on the winemaking process. Factors such as phenolic maturity of the grapes, leng-th of maceration, frequency of pumping over, etc. de-termine the final wine phenolic content (1–3).

The importance of oxygen in the evolution of wine color has been studied for many years, both as regards its role in polyphenol oxidation (4–7) and as a promo-ter of the formation on new anthocyanin-derived compounds (5, 8–11). Indeed, one way of manipu-lating the phenolic structure of a wine is to use the micro-oxygenation (MO) technique, which relies on the formation of microbubbles through the injection of gaseous oxygen into the wine using a microdiffuser (12). These bubbles rise through the wine, dissolving as they travel to the surface.

Empirical results have indicated that MO benefits in-clude the stabilization of wine color, the softening of tannins, and the lessening of vegetative aromas (13, 14). Reactions involving wine polyphenols are the key to these processes, which include changes in proan-thocyanin chain length and the consequent effect on wine astringency and the linking of anthocyanins and tannins to form more stably colored forms. Dissolved oxygen leads to the formation of acetaldehyde that, in turn, reacts with flavanols and anthocyanins to induce the formation of a very reactive carbocation that quic-kly reacts with another flavanol molecule or with an-thocyanin, producing ethyl bridge-linked compounds (15, 16). They are unstable (17) and undergo reactions that lead to the formation of new compounds such as flavanyl pyranoanthocyanins. These end products are more stable and colored than the original com-pounds (11). Moreover, incorporation of anthocyanin into tannin structures also may lead to a decrease in astringency (18).

Since its commercial adoption, MO has become com-mon practice and is now used worldwide, although most of the available information is from empirical re-sults. Only a few scientific publications can be found that are related to the effects of MO (8, 19–23). Several factors may affect the final results obtained by MO, the most important being the moment of application, doses of oxygen, and wine characteristics. Wines have marked differences in their respective abilities to con-sume oxygen. As a general rule, this facility is directly related to their relative concentration of polyphenols since phenolic compounds are the main consumers of oxygen (60%) together with ethanol (20%) and SO

2

(12%) (22). In our first studies, we tested the use of di-fferent doses of oxygen and the effect of the moment of application on wine chromatic characteristics (23, 24). Here, we report the results of a commercial scale MO experiment where the influence of applying oxy-gen to three wines made from Monastrell grapes of

J. Agric. Food Chem. 2008, 56, 5932–5941

Text

os a

soci

ados

91


different phenolic contents was investigated.

MATERIALS AND METHODS

Wine Samples. Three different red wines, made from Vitis Vinifera var. Monastrell (2005 vintage), differing in their total phenol content, were used for the ex-periment (W1, W2, and W3). Each wine was distribu-ted into four 17 500 L tanks, and the MO experiment was carried out in triplicate, with a control (C) and three MO tanks for each type of wine. The height of each tank was 4.5 m, enough for the complete dissolution of oxygen microbubbles into the wine. MO began just after alcoholic fermentation had fi-nished (November 7, 2005), applying a oxygen dose of 10 mL/L/month. Malolactic fermentation (MLF) occurred spontaneously. When MLF started (detec-ted by the decrease in malic acid), the MO system was stopped (November 30 for W1 and December 20 for W2 and W3). During MLF, the bacteria consu-me the acetaldehyde produced. They are capable of metabolizing acetaldehyde, even the acetaldehyde bound to sulfur dioxide (25); therefore, any excess of acetaldehyde produced during the MO process will disappear.

When MLF was complete for all wines, SO2 was added

to leave the wines with a free SO2

content close to 30 mg/L, and MO was resumed (January 19, 2006). At this moment, the oxygen supply was reduced to avoid accumulation of acetaldehyde (3 mL/L/month). After 2 months, the oxygen supply was reduced again (1.5 mL/L/month) before it was completely stopped. The wine was analyzed immediately before the MO system began (t0), at the beginning of MLF (t1), when MO be-gan again after MLF (t2), and 15 days after the MO system was stopped (t3) since wines take 8-10 days to absorb the oxygen, depending on temperature and phenolic composition of the wines (26). The MO system (Agrovin S.A., Alcazar de San Juan, Spain) was comprised of an oxygen cylinder (food grade) and a dosing chamber that allowed the doses of oxygen flowing through nine different microdiffusers to be programmed.

General Determinations. pH and titratable acidity were measured using an automatic titrator (Metrohm, Herisau, Switzerland). Volatile acidity was determined according to the OIV Official Methods (27). Acetalde-hyde and malic acid concentration were determined using enzymatic test kits from Roche Boehringer, Mannheim, Germany. The SO

2 concentration (free

and total) was measured iodometrically by the Ripper procedure (28) modified to detect the end point po-tentiometrically with an automatic titrator (Metrohm, Herisau, Switzerland).

Identification and Quantification of Anthocya-nins. Wines were analyzed by direct injection of the samples previously filtered through a 45 μm nylon fil-ter (Teknokroma, Barcelona, Spain). The HPLC analyses were performed on a Waters 2690 liquid chromato-graph (Waters, Milford, MA), equipped with aWaters 996 diode array detector and a 250 mm × 4 mm i.d., 5 μm particle size Lichrocart RP-18 column (Merck, Darmstadt, Germany), using as solvents 4.5% aqueous formic acid (solvent A) and acetonitrile (solvent B) at a flow rate of 0.8 mL/ min. Elution was performed with a gradient starting with 10% B to reach 14.5% B at 30 min, 15.2% B at 45 min, 18% B at 60 min, 25% B at 100 min, and 25-100% B in 30 min. Chromatograms were recorded at 520 nm.

Compounds were identified by comparing their UV spectra recorded with the diode array detector and those reported in the literature (11, 29). In addition, an HPLC-MS analysis was conducted to confirm each peak identity. An LC-MSD-Trap VL-01036 liquid chromatograph-ion trap mass detector (Agilent Te-chnologies, Waldbronn, Germany) equipped with an electrospray ionization (ESI) system was used. Elution was performed with the HPLC analysis conditions detailed previously. The heated capillary and volta-ge were maintained at 350 °C and 4 kV, respectively. Mass scans (MS) were measured from m/z 300-1100. Mass spectrometry data were acquired in the positi-ve ionization mode. Anthocyanins and anthocyanin-

Table 1. Evolution of Some Physicochemical Parameters during MO of Monastrell Winesa

t0 t1 t2 t3

W1 W1 (C)

W1 (MO)

W1 (C)

W1 (MO)

W1 (C)

W1 (MO)

pH titratable acidityb

volatile acidityc free SO2 (mg/L) total SO2 (mg/L)

acetaldehyde (mg/L)

3.72 5.87 0.39 25 39

22.2

3.78 5.76 0.40 26 32

13.5

3.76 5.35* 0.41 22* 28* 12.8

3.85 5.38 0.43 37 50

15.1

3.83 5.17* 0.47 37 49

16.6

3.83 5.06 0.42 22 48

21.3

3.79* 4.90* 0.34 14* 46

32.6*

W2 W2 (C)

W2 (MO)

W2 (C)

W2 (MO)

W2 (C)

W2 (MO)



acetaldehyde (mg/L)

3.66 6.31 0.33 25 41

29.1

3.71 5.83 0.33 31 35

23.0

3.67 5.96 0.34 22* 33

24.7

4.00 5.60 0.29 38 61

32.2

4.00 5.73* 0.32 33 61

23.4*

3.83 5.08 0.37 16 51

41.4

3.80 4.90 0.33 11* 35* 45.2

W3 W3 (C)

W3 (MO)

W3 (C)

W3 (MO)

W3 (C)

W3 (MO)



acetaldehyde (mg/L)

3.63 6.45 0.40 27 48

32.3

3.66 5.70 0.37 32 44

25.6

3.66 5.56 0.38 25* 35

23.2

4.01 5.66 0.33 26 64

28.7

4.02 5.27* 0.37 29 64

28.4

3.77 5.09 0.37 16 61

22.3

3.78 4.89* 0.39* 11* 38*

35.0* a An asterisk indicates significant differences between control and microoxygenated wines for each time con-sidered. b Expressed as g/L of tartaric acid.c Expressed as g/L of acetic acid.

92

Seminario Técnico


derived compounds were quantified at 520 nm as malvidin- 3-glucoside, using malvidin-3-glucoside chloride as an external standard (Extrasynthe`se, Ge-nay, France).

Color Determinations in Wines. Absorbance measu-rements were made in a Helios Alpha spectrophoto-meter (Thermo Electron Corp., Waltham, MA) with 0.1, 0.2, or 1 cm path length glass cells. Samples were pre-viously centrifuged, and the pH was adjusted to 3.6. CIELab parameters were determined by measuring the transmittance of the wine every 10 nm from 380 to 770 nm, using a D65 illuminant and a 10° observer. The L* (measure of lightness), C* (measure of chroma), and H* (hue angle) parameters were determined. Co-lor intensity (CI), calculated as the sum of absorbance at 620, 520, and 420 nm, and percentages of red (%R), yellow (%Y), and blue (%B) color were determined ac-cording to Glories (30); the hue was calculated as the ratio between absorbance at 420 nm and absorbance at 520 nm (31).

Total phenols (abs280) were calculated according to Ribe´reau Gayon et al. (32). Wine color (WC), total color of pigments (WCP), and color due to derivatives resis-tant to SO

2 bleaching (CDRSO

2) were determined using

a method adapted from that described by Levengood and Boulton (33), with all measurements made at 520 nm. These parameters were calculated as follows.

WC. Twenty microliters of 10% acetaldehyde solution was added to 2 mL of a wine sample in a 10 mm plas-tic cuvette to release any anthocyanins involved in bi-sulfite adducts. After 45 min, the sample was placed in a 1 mm cuvette. The reading was corrected to 10 mm path length by multiplying by 10.

WCP. A total of 0.5 mL of wine was diluted in 20 mL of 0.1 N HCl. Absorbance was measured in a 10 mm cuvette after 30 min to ensure complete conversion of anthocyanins into the flavylium form. The reading was corrected for dilution.

CDRSO2. A total of 160 μL of a 5% SO2 solution (10%

potassium metabisulfite solution) was added to 2 mL of the wine sample. After 1 min, the sample was pla-ced in a 2 mm cuvette. The reading was corrected to 10 mm path length by multiplying by 5.

Determination of Total Tannins. The wine tannin concentration was evaluated using a protein pre-cipitation assay, with bovine serum albumin (BSA). Sample preparation and a protein precipitation assay were conducted according to methods described by Harbertson et al. (34). For quantification, results were compared with a (+)-catechin standard and reported as mg/L (+)-catechin equivalents.

Analysis of Proanthocyanidins. Proanthocyanidin composition was determinated by HPLC-DAD-MS af-

ter purification and concentration of the wine extract and acid catalysis in the presence of excess phloro-glucinol. The results of phloroglucinolysis provided information on the proanthocyanidin subunit com-position (terminal and extension unit concentrations) and the mean degree of polymerization (mDP). The analyses were carried out in triplicate.

The phloroglucinolysis protocol, described by Drinki-ne et al. (35), included a purification step using C18 solid-phase extraction (SPE). Water (15 mL) was added to 5 mL of wine, and the sample was passed through a preconditioned cartridge. The retained compounds were eluted with 50 mL of methanol with a flow rate of 2 mL/min. This fraction was dried under reduced pressure and then dissolved in 2 mL of methanol.

The second step was the phloroglucinolysis reaction. A solution of 0.2 N HCl in methanol, containing 100 g/L phloroglucinol and 20 g/L ascorbic acid, was pre-pared. A total of 100 μL of the wine sample was reac-ted with 100 μL of the phloroglucinol reagent at 50 °C for 20 min, and then 1 mL of 80 mM aqueous sodium acetate was added to stop the reaction.

The extension and terminal units resulting from phloroglucinolysis (catechin, epicatechin, (epi)ca-techin gallate, and (epi)gallocatechin) were deter-mined by LC-MS. LC-MS analyses were performed on a Micromass Platform II simple quadruple mass spectrometer (Micromass- Beckman, Roissy Charles-de-Gaulle, France) equipped with an electrospray ion source. The mass spectrometer was operated in negative-ion mode. The source temperature was 120 °C, the capillary voltage was set at 3.5 kV, and the cone voltage was -30 V. HPLC separations were per-formed on a Hewlett-Packard 1100 series (Agilent, Massy, France) instrument including a pump modu-le and a UV detector. Both systems were operated using Masslynx 3.4 software. The absorbance was re-corded at 280 nm, and mass spectra were recorded from 200 to 1200 amu.

The elution conditions were wateras follows: acetic acid (99:1; v/v) as solvent A, methyl alcohol as solvent B, and the following elution gradient: from 5 to 15% B in 5 min, 15% B for 2 min, from 15 to 20% B in 3 min, from 20 to 50% B in 10 min, from 50 to 100% B in 2 min, and from 100 to 5% B in 2 min, with a flow of 1 mL/min. The column used was a reversed-phase 4.6 mm × 100 mm i.d., 3.5 μm packing C18 Waters Xterra protected with a guard column of the same material (Agilent, Saint Quentin-en-Yvelines, France).

Statistical Analysis. Significant differences between wines and for each variable were assessed with analy-sis of variance (ANOVA). This statistical analysis, toge-ther with a cluster analysis and a principal compo-nents analysis, was performed using Statgraphics 5.1 (Statistical Graphics Corporation, Rockville, MD).

Text

os a

soci

ados

93


RESULTS AND DISCUSSION

When comparing the initial composition of the studied wines (Table S1 in the Supporting Information and ini-tial point in all figures), W1 and W2 showed a very simi-lar phenolic content (abs280 of 52 and 58, respectively), while the highest phenolic content was found in W3 (abs280 of 76), mainly due to its high tannin content. Although tannins and color density were higher in W3, monomeric anthocyanins and WCP showed higher va-lues in W2, a wine that showed a low degree of anthoc-yanin polymerization (CRDSO2). Color percentages also differed between the wines. W1 presented a higher ye-llow percentage and lower red percentage. W3 was the darkest wine, with the highest blue percentage. The tannin characterization showed that the percentages of the different flavanol units also differed. The profi-le of W1, with the highest percentage of epicatechin and epigallocatechin, indicated a high percentage of skin tannins (18, 36), whereas the lowest percentage of epigallocatechin and relatively high percentage of epicatechin gallate in W3 were according to the lon-ger maceration period used during the elaboration of W3, with seed tannins contributing significantly to the tannin fraction. The profile found in W2 indicates

an intermediate situation, the maceration time being intermediate between W1 and W3.

As seen in Table 1, there was little effect of MO on pH, and small differences were observed in titratable aci-dity after MLF (t2) and at the end of the experiment (t3). With regard to concerns about potential micro-bial spoilage, the volatile acidity did not increase du-ring the studied period. When the MO application was finished, a higher concentration of acetaldehyde was detected in the W1 and W3 MO wines, as compared to their control counterparts, and similar quantities of acetaldehyde were found in W2 (C) and W2 (MO). Excessive oxidation may result in increased levels of acetaldehyde, a compound that at sensory threshold levels adversely affects wine flavor and aroma. Sensory detection limits for red wines are typically in the range of 40-100 ppm (37, 38). Our results showed that, even in wines containing the highest content of acetalde-hyde, its sensory detection limit barely was reached.

MO promoted a slightly lower content of free SO2

in the wines, but differences were small. Total SO2

was also lower in W2 and W3 MO wines. Boulet and Moutounet (12) reported no effect of MO on SO

2

Figure 1. Development of monomeric anthocyanins and ethyl-linked compounds in W1, W2, and W3 wines (±SD). Each point corresponds to t0, t1, t2, and t3.

94

Seminario Técnico


content, whereas Pérez-Magariño et al. (39) reported small decreases due to MO, results that are similar to our findings. The results of Tao et al. (21) showed that SO

2 had a moderating effect on the interaction of oxy-

gen with wine polyphenols since it has the ability to reduce oxidized polyphenols and to remove peroxide. The levels of SO

2 in MO wine affect the rate of deve-

lopment of wine polyphenol chemistry, including the formation of polymeric pigments and changes in tan-nin structure, affecting wine astringency.

Anthocyanins and Derived Compounds. The predo-minant compounds detected in HPLC analyses were the monoglucosides of malvidin, petunidin, delphinidin, peonidin, and cyanidin and their respective acetyl and coumaryl derivatives. The combined concentration of all these compounds diminished with time (Figure 1) the decrease being larger in the MO wines, as also found by Atanasova et al. (8), a decrease that might be explained by the various reactions where anthocyanins are invol-ved, including degradation or polymerization reactions. The most significant decrease was detected between t0 and t2, except in W1, whose concentrations barely chan-ged during this period. This was probably due to the fact that W1 wines were MO for 17 days before MLF started,

whereas W2 and W3 were MO for 44 days since the star-ting of MLF was delayed in these wines.

Acetaldehyde-mediated condensation between an-thocyanin- 3-glucoside and (epi)catechin leads to ethyl bridge-linked compounds. Three possible iso-mers were elucidated as well as another compound in which the flavanyl moiety is a dimer. Throughout the experiment, the concentration of ethyl-linked com-pounds was higher in the MO wines (Figure 1). These are compounds with a purple color, less sensitive to bleaching by SO

2 and pH than monomeric anthocya-

nins, and their formation is favored by oxygen (8, 40). A very large increase was observed in W2 (MO) from t0 to t1, after which it fell sharply. These compounds are unstable and have a tendency to increase in size in the presence of available acetaldehyde. The behavior is in accordance with their reactivity; they are rapidly formed, but also, they can be rapidly broken down, releasing ethyl-flavanol units that, in turn, may react again with anthocyanins or dimers, giving more con-densed products or even polymers (11).

Pyroanthocyanins are compounds formed when a pyran ring is introduced between the C4 and the

Figure2. Development of carboxypyranoanthocyanins and sum off lavanyl- and vinylpyranoanthocyanins in W1, W2, and W3 wines (±SD).Each point corresponds to t0, t1, t2, and t3.

Text

os a

soci

ados

95


lated compounds during the first year of wine stora-ge, after which the concentration remained relatively constant (42–44). Such a decrease, observed mainly in our study between t1 and t2, was ascribed to their in-corporation into polymeric compounds (42). The con-centration of carboxypyranoanthocyanins in wines is a result of a balance between the formation reactions and their incorporation in the polymeric compounds. The formation of vitisin A and related compounds requires the presence of free monoglucosides and pyruvic acid. Oxygen or reactive oxygen species are also necessary for the reaction to proceed since all cycloaddition pathways require an oxidation step to recover the flavylium moiety within the final struc-tures (45–47). Therefore, the MO process seemed to enhance the formation of vitisin-type compounds by providing oxygen. This result is contrary to that of Ata-sanova et al. (8), who stated that the addition of pyru-vic acid to anthocyanins is not influenced by oxygen. W2, with a higher anthocyanin monoglucoside con-tent (as quantified by HPLC), was the wine showing the highest final concentration of carboxypyranoan-thocyanins.

Another group of anthocyanins, constituted by hydroxyphenyl- pyranoanthocyanins, results from

Figure 3. Development of direct anthocyanin-flavanol adducts and polymeric compounds in W1, W2, and W3 wines (±SD). Each point corresponds to t0, t1, t2, and t3.

hydroxyl group attached to C5 in the anthocyanin molecule. Some compounds result from the addi-tion of anthocyanin and pyruvic acid (carboxypyra-noanthocyanins). Several of these compounds were detected in our samples: petunidin 3-glucoside pyru-vate, vitisin A (malvidin 3-(glucoside)pyruvate), acetyl vitisin A (malvidin 3-(acetylglucoside) pyruvate), and coumaryl vitisin A (malvidin 3-(coumarylglucoside) pyruvate). Another pyranoanthocyanin resulting from the cycloaddition of acetaldehyde to malvidin 3-glu-coside, and referred to as vitisin B, also was found, and its quantification was included with the carboxypyra-noanthocyanins. Pyranoanthocyanins are considered to be important compounds concerning the color of red wine since the cycloaddition process seems to strongly increase the stability of the products, and, in this way, vitisin A has been reported as being more stable than malvidin 3-glucoside or ethyl-linked com-pounds and more resistant to oxidation (41). The sum of carboxypyranoanthocyanins and vitisin B increa-sed from t0 to t1 (Figure 2), with MO wines increasing more (except for W1). At the end of the experiment, carboxypyranoanthocyanins showed lower concen-trations in the control wines than in the MO wines, the greatest increases being detected in W2. Other authors found a strong decrease in vitisin A and re-

96

Seminario Técnico


the reactions of anthocyanins and vinyl derivatives (48, 49). Malvidin 3-glucoside- 4-vinylphenol, pinotin A (malvidin 3-glucoside-4-vinylcatechol), and malvi-din 3-glucoside-4-vinylguaiacol were detected in our samples. The presence of vinyl derivatives in wine was attributed to enzymatic decarboxylation of phenolic acids by yeast enzymes (48). However, Schwarz and Winterhalter (50) demonstrated that pinotin A also could be formed as a result of the direct addition of caffeic acid to malvidin-3-glucoside, without the need for prior decarboxylation of cinnamic acid derivatives by wine yeasts (51). Also, flavanylpyranoanthocyanin was detected in our samples. We found that the con-centration of vinyl and flavanylpyranoanthocyanins increased with time (Figure 2), the increases being lar-ger in the MO wines, especially from t2 to t3.

We also detected compounds formed by direct reac-tions between anthocyanins and flavanols (Figure 3). These may result from the addition of flavanols to an-thocyanins (47, 52). Little differences were detected in the direct adducts between control and MO wines.

A broad peak at the end of the chromatogram was observed (polymeric peak). It absorbed at around 540, indicating that it contained flavylium units. Its con-

centration increased with time while its λmax value decreased, perhaps because anthocyaninethyl- fla-vanol adducts would first have been formed during winemaking and then transformed into flavanyl-pyra-noanthocyanins during wine aging, compounds that present lower λmax values. The contribution of these polymeric pigments to the overall color of aged red wines may be superior to the contribution of either genuine monomeric anthocyanins or pyranoanthoc-yanins (50). The area of this peak, as shown in Figure 3, is larger, in general, in MO wines, although no signifi-cant differences were observed between W3 (C) and W3 (MO) at the end of the experiment.

Chromatic Characteristics of Wine. Figure 4 reflects the evolution of color intensity and hue. The wines behaved in a similar way, independently of their phe-nolic content. An increase from t0 to t1 was obser-ved in all wines and was higher in MO wines, these wines also being darker in color (see Table S2 in the Supporting Information). A decrease during MLF was then detected, probably due to an increase in pH and the degradation of pigmented compounds by lactic bacteria. After MLF, CI increased, although MO wines maintained a statistically higher CI value. The higher CI in MO wines was probably due to the contribution of

Figure 4. Development of color intensity and hue in W1, W2, and W3 wines (±SD). Each point corresponds to t0, t1, t2, and t3.

Text

os a

soci

ados

97


the newly formed pigments, for example, ethyllinked pigments, since the absorbance of these molecules at 620 nm is higher than that of genuine anthocyanins (the percentage of blue color in MO wines was higher than in control wines).

Pyranoanthocyanins also may have participated in the higher CI as they show both higher absorbance at 420 nm and contribute to the redness of wines. The hue evolved in a very similar way in all the wines, with a tendency to increase, but more so in control wine, demonstrating that no detectable browning occurred in the MO wines.

Figure 5 reflects the evolution of WC, WCP, and CRD-SO

2. A very small decrease in WC was observed in all

wines with no differences due to MO. WCP decreased with time, and the decreases were concomitant with the loss of free anthocyanins usually observed during wine evolution, meaning that the formation of antho-cyanin-derived pigments did not compensate for free anthocyanin degradation.

A continuous increase in pigments resistant to SO2

bleaching was observed. The formation of pyranoan-thocyanins, which are very stable compounds toward

Figure 5. Development of WC, WCP, and CRDSO2 in W1, W2, and W3 wines (±SD). Each point corresponds to t0, t1, t2, and t3.

Figure 6. Development of abs280 and tannins in different wines (±SD). Each point corresponds to t0,

t1, t2, and t3.

98

Seminario Técnico


SO2

and pH due to the substitution of C4 (47), was probably associated with this evolution. Ethyl-linked compounds also should be resistant to sulfite addi-tion and may have contributed to the observed chan-ges, explaining as to why the values were higher in MO wines.

With regard to optical density and tannin content (Fi-gure 6) and mean degree of polymerization (mDP) (Fi-gure 7), no changes in abs280 were detected in any of the wines, indicating the absence of significant wine pigment precipitation. As regards tannins, their levels decreased during MLF in W2 and W3, but since no decrease in abs280 was detected, this phenomenon was probably due to tannins breaking down to give small structures that were not detected by the BSA method. Similar values for the control and MO wines were observed at t2. From t2 to t3, the concentration barely changed, although MO wines showed a slightly higher tannin content.

Different behavior with regard to mDP was observed for the different wines. This parameter always increased in the first period (from t0 to t1) for all wines and then fell, except for W1. According to Nikfardjam and Dykes (53), this increase corresponds to the wine structuring phase described in empirical observations (13), and this phase appears to occur irrespective of whether oxygen is being dosed into the wine. The reduction of mDP ob-served afterward, mainly in W2 (MO) and W3 (MO), may be due to a possible structural rearrangement of the tannins to shorter forms, which would correlate with the small decreases observed in the tannins measured by the BSA method. This reduction in mDP may be res-ponsible for a reduction in wine astringency (54, 55). The interaction of these newly formed intermediates with anthocyanins also may reduce astringency since they can form terminal units of these shorter forms, preventing further polymerization (56). The different behavior of W1 (MO) was similar to that described by Du Toit et al. (57) when MO was applied to a wine for too long a period of time. It seems that W1 could have suffered overoxygenation in the MO wine, and therefo-re, an increase of mDP was observed.

Multivariate statistical analysis was used in this study to check as to whether the wines could be grouped according to the variables studied. First, a cluster analysis was conducted using all the studied variables since this is a powerful visualization tool that enables groupings to be observed within the data. This is an unsupervised method for pattern recognition, where the samples were clustered without prior knowledge of their belonging to any wine type. The distance ma-trix was calculated using square Euclidean distances and an average linkage method algorithm. Distance measures the similarity or dissimilarity between the different samples. Two clearly differentiated clusters were found (data shown in Supporting Information). In one of them we found W1, both control and MO wi-nes, and W2 (C), showing that W1 (C) and W2 (C) were quite close. W2 (MO) was classified as closer to the W3 wines. In the case of W2, it seems that MO originated the maximum differences in the wine characteristics. MO promoted changes in its phenolic structure, lea-ding to a wine with chromatic characteristics closer to a wine with a higher phenolic content.

Figure 8. Graphical plot representing the distribution of the wine samples in the plane defined by principal components 1 and 2 as

regards their chromatic characteristics (MO wines: solid symbols; control wines: open symbols; W1:

circles; W2: squares; and W3: triangles). The variance explained by each principal component is

shown in parentheses.

Figure 7. Development of mean degree of polymerization of tannins in W1, W2, and W3 wines

(±SD). Each point corresponds to t0, t1, t2, and t3.

Text

os a

soci

ados

99


Having obtained this grouping, a principal compo-nents analysis was conducted with the same data and using the same variables to find as to which variables were mainly responsible for the grouping found (Figure 8). The first two principal components explained 83% of the variance. The representation of these two principal components showed that all MO wines had lower values in component 1 than their corresponding control wines mainly due to lower va-lues of L*, H*, and hue and higher values of CI and anthocyanin-derived compounds, among others. The wines with the highest phenolic content showed ne-gative values of PC1, while W2 differed from the other wines especially in the highest values of PC2, due to the high WC and anthocyanin monoglucoside values. W2 (MO) and W3 (C) were again very close. MO favo-red reactions that led to the greater formation of new pigments, which, in turn, increased CI and CRDSO

2 in

all the wines, regardless of their phenolic content. W1 wine was less influenced by MO and the observed increases in mDP for W1 (MO) suggested overoxyge-nation. This wine presented an anthocyanin content that was too low to promote any great level of con-densation reactions. W3 was favored by MO, but the most evident results were found in W2 (MO), with its high anthocyanin content that favored the formation of more stable derived pigments and led to a wine close to W3 (C).

Supporting Information Available: Figure of diffe-rentiated clusters and tables of wine characteristics at the end of alcoholic fermentation and evolution of CIELab and color. This material is available free of char-ge via the Internet at http://pubs.acs.org.

LITERATURE CITED

(1) Pérez-Magariño, S.; González-San José, M. L. Evolu-tion of flavanols, anthocyanins, and their deriva-tives during the aging of red wines, elaborated from grapes harvested at different stages of ripe-ning. J. Agric. Food Chem. 2004, 52, 1181–1189.

(2) Bautista-Ortıń, A. B.; Fernández-Fernández, J. I.; López-Roca, J. M.; Gómez-Plaza, E. The effect of grape ripening stage on red wine color. J. Int. Sci. Vigne Vin 2006, 40, 14–24.

(3) Bautista-Ortıń, A. B.; Fernández-Fernández, J. I.; Ló-pez-Roca, J. M.; Gómez-Plaza, E. Wine-making of highly colored wines: Extended pomace contact and run-off of juice prior to fermentation. Food Sci. Technol. Int. 2004, 10, 287–295.

(4) Ribéreau-Gayon, P.; Glories, Y. Phenolics in grapes and wines. In The Sixth Australian Wine Industry Technical Conference; Lee, T. H., Ed.; Australian In-dustrial Publishers: Adelaide, Australia, 1986; pp 247-256.

(5) Singleton, V. A survey of wine aging reactions, es-pecially with oxygen. In Proceedings of the 50th AnniVersary Annual Meeting; Rantz, J. M., Ed.; American Society for Enology and Viticulture: Davis, CA, 2000; pp 323-336.

(6) Singleton, V. Oxygen with phenols and related reactions in must, wines, and model systems: Observations and practical implications. Am. J. Enol. Vitic. 1987, 38, 69–77.

(7) Danilewicz, J. Review of reaction mechanism of oxygen and proposed intermediate reduction products in wine: Central role of iron and copper. Am. J. Enol. Vitic. 2003, 54, 73–85.

(8) Atanasova, V.; Fulcrand, H.; Cheynier, V.; Moutounet, M. Effect of oxygenation on polyphenol changes occurring in the course of wine-making. Anal. Chim. Acta 2002, 458, 15–27.

(9) Jordao, A. M.; Ricardo-da-Silva, J. M.; Laureano, O. Effect of oak constituents and oxygen on the evolution of malvidin-3- glucoside and (+)-cate-chin in model wine. Am. J. Enol. Vitic. 2006, 57, 377–381.

(10) Salmon, J. M. Interactions between yeast, oxygen, and polyphenols during alcoholic fermentations: Practical implications. Food Sci. Technol. 2006, 39, 959–965.

(11) Alcalde-Eon, C.; Escribano-Bailon, M. T.; Santos-Buelga, C.; Rivas-Gonzalo, C. Changes in the de-tailed pigment conposition of red wine during maturity and ageing. A comprehensive study. Anal. Chim. Acta 2005, 563, 238–254.

(12) Boulet, J.; Moutounet, M. Micro-oxigenación de los vinos. In Enologıá: Fundamentos Cientı´ficos y Tecnológicos; Flanzy, C., Ed.; MundiPrensa Edi-ciones: Madrid, 2000; pp 638-642.

(13) Parish, M.; Wollan, D.; Paul, R. Micro-oxygenation. A review. Aust. Grapegrower Winemaker 2000, 438, 47–50.

(14) Kamio, I.; Kamio, X.; Roig, G.; Otero, B.; Yerle, S. Microoxygenation dans la Péninsule Ibérique: Repenser l’elevage des vins du sud. ReV. Oenol. 2008, 126, 22–27.

(15) Dallas, C.; Ricardo da Silva, J. M.; Laureano, O. Pro-ducts formed in model wine solutions involving anthocyanins, procyanidin B2, and acetaldehyde. J. Agric. Food Chem. 1996, 44, 2402–2407.

(16) Es-Safi, N.; Fulcrand, H.; Cheynier, V.; Moutounet, M. Studies on the acetaldehyde-induced condensa-tion of (-)-epicatechin and malvidin-3-glucoside

100

Seminario Técnico


in model solution systems. J. Agric. Food Chem. 1999, 47, 2096–2102.

(17) Escribano-Bailon, T.; Alvarez-Garcia, M.; Rivas-Gonzalo, J. C.; Heredia, F. J.; Santos-Buelga, C. Color and stability of pigments derived from the acetaldehyde-mediated condensation between malvidin 3-O-glucoside and (+)-catechin. J. Agric. Food Chem. 2001, 49, 1213–1217.

(18) Cheynier, V.; Dueñas, M.; Salas, E.; Maury, C.; Souquet, J.; Sarni- Manchado, P.; Fulcrand, H. Structure and properties of wine pigments and tannins. Am. J. Enol. Vitic. 2006, 57, 298–305.

(19) Llaudy, M.; Canals, R.; Gonzalez-Manzano, S.; Ca-nals, J. M.; Santos-Buelga, C.; Zamora, F. Influen-ce of micro-oxygenation treatment before oak aging on phenolic compound composition, as-tringency, and color of red wine. J. Agric. Food Chem. 2006, 54, 4246–4252.

(20) Pérez-Magariño, S.; Sánchez-Iglesias, M.; Ortega-Heras, M.; González-Huerta, C.; González-Sanjose, M. L. Color stabilization of red wines by microoxy-genation treatment before malolactic fermenta-tion. Food Chem. 2007, 101, 881–893.

(21) Tao, J.; Dykes, S. I.; Kilmartin, P. A. Effect of SO2

concentration on polyphenol development du-ring red wine micro-oxygenation. J. Agric. Food Chem. 2007, 55, 6104–6109.

(22) Devatine, A.; Chiciuc, I.; Poupot, C.; Mietton-Peu-chot, M. Microoxygenation of wine in presen-ce of dissolved carbon dioxide. Chem. Eng. Sci. 2007, 62, 4579–4588.

(23) Cano-Lopez, M.; Pardo, F.; Lopez-Roca, J. M.; Gó-mez-Plaza, E. Effect of the micro-oxygenation on anthocyann and derived pigment content and chromatic characteristics of red wines. Am. J. Enol. Vitic. 2006, 57, 325–331.

(24) Cano-López, M.; López-Roca, J. M.; Gómez-Plaza, E.; Pardo- Minguez, F. Efecto de la microoxigena-ción en vinos tintos con diferente contenido po-lifenólico. Tecnol. Vino 2006, Julio-Agosto, 45–50.

(25) Osborne, J.; Mira de Orduña, R.; Pilone, G.; Liu, S. Acetaldehyde metabolism by wine lactic acid bacteria. FEMS Microbiol. Lett. 2000, 191, 51–55.

(26) Vivas, N.; Glories, Y. Racking of red wine matured in barrels. A tentative classification of racking tech-niques. Aust. NZ Wine Ind. J. 1995, 10, 241–243.

(27) O.I.V. Recueil des Méthodes Internationales d’Analyse des Vins et des Mouts; Office Interna-tional de la Vigne et du Vin: Paris, 1990.

(28) Ough, C. S.; Amerine, M. A. Methods for Analysis of Musts and Wine; Wiley Interscience Publications: Νew York, 1974.

(29) Boido, E.; Alcalde-Eon, C.; Carrau, F.; Dellacassa, E.; Rivas- Gonzalo, C. Aging effect of the pigment composition and color of Vitis Vinifera L. c.v. Tan-nat wines. Contribution of the main pigment fa-milies to wine color. J. Agric. Food Chem. 2006, 54, 6692–6704.

(30) Glories, Y. La coleur des vins rouges: 1° partie. Les equilibres des anthocyanes et des tanins. Con. Vigne Vin 1984, 18, 195– 217.

(31) Sudraud, P. Interpretation des courbes d’absortion des vins rouges. Ann. Technol. Agric. 1958, 7, 203–208.

(32) Ribéreau Gayon, P.; Glories, Y.; Maujean, A.; Du-bourdieu, D. Traité d’Oenologie. 2. Chimie du Vin. Stabilisation et Traitements; Dunod: Paris, 1998.

(33) Levengood, J.; Boulton, R. The variation in color due to copigmentation in young Cabernet Sau-vignon wines. In Red Wine Color. ReVealing the Mysteries; Waterhouse, A., Kennedy, J., Eds.; Ame-rican Chemical Society: Washington, DC, 2004; pp 35- 52.

(34) Harbertson, J. F.; Kennedy, J. A.; Adams, D. O. Tan-nin in skins and seeds of Cabernet Sauvignon, Syrah, and Pinot Noir berries during ripening. Am. J. Enol. Vitic. 2002, 53, 54–59.

(35) Drinkine, J.; Lopes, P.; Kennedy, J. A.; Teissedre, P. L.; Saucier, C. Analysis of ethylidene-bridged fla-van-3-ols in wine. J. Agric. Food Chem. 2007, 55, 1109–1116.

(36) Fernandez, K.; Kennedy, J. A.; Agosin, E. Characteri-zation of Vitis Vinifera L. Cv. Carmanere grape and wine proanthocyanidins. J. Agric. Food Chem. 2007, 55, 3675–3680.

(37) Peynaud, E. The Taste of Wine; Wiley: New York, 1996.

(38) Amerine, M.; Roessler, E. Wines, Their Sensory EVa-luation; W. H. Freeman: New York, 1982.

(39) Perez-Magariño, S.; Sánchez-Iglesias, M.; Ortega-Heras, M.; González-Huerta, C.; González-Sanjosé, M. L. Color stabilization of red wines by microoxy-genation treatment before malolactic fermenta-tion. Food Chem. 2007, 101, 881–893.

(40) Rivas-Gonzalo, J.; Bravo-Haro, S.; Santos-Buelga, C. Detection of compounds formed through the reaction of malvidin-3- monoglucoside and ca-

Text

os a

soci

ados

101


techin in the presence of acetaldehyde. J. Agric. Food Chem. 1995, 43, 1444–1449.

(41) Morata, A.; Gomez-Cordoves, C.; Colomo, B.; Sua-rez, J. A. Pyruvic acid and acetaldehyde by di-fferent strains of Saccharomyces cereVisiae: Re-lationship with vitisin A and B formation in red wines. J. Agric. Food Chem. 2003, 51, 7402–7409.

(42) Schwartz, M.; Quast, P.; von Baer, D.; Winterhalter, P. Vitisin A content in Chilean wines from Vitis Vi-nifera cv. Cabernet Sauvignon: A contribution to the color of aged red wines. J. Agric. Food Chem. 2003, 51, 6261–6267.

(43) Revilla, I.; González-San José, M. L. Evolution du-ring the storage of red wines treated with pecto-lytic enzymes: New anthocyanin pigment forma-tion. J. Wine Res. 2001, 12, 183–197.

(44) Asestorfer, R.; Markides, A.; Iland, P.; Jones, G. For-mation of vitisin A during red wine fermentation and maturation. Aust. J. Grape Wine Res. 2003, 9, 40–46.

(45) Lee, D.; Swinny, E.; Asenstorfer, R.; Jones, G. Factors affecting the formation of red wine pigments. In Red Wine Color. ReVealing the Mysteries. ACS Symposium Series 886; Waterhouse, A., Kennedy, J. A., Eds.; American Chemical Society: Washing-ton, DC, 2004; pp 125-142.

(46) Pozo-Bayon, M. A.; Monagas, M.; Polo, M. C.; Go-mez-Cordoves, C. Occurrence of pyroanthocya-nins in sparkling wines manufactured with red grape varieties. J. Agric. Food Chem. 2004, 52, 1300–1306.

(47) Fulcrand, H.; Atanasova, V.; Salas, E.; Cheynier, V. The fate of anthocyanins in wine. Are they de-termining factors? In Red Wine Color. ReVealing the Mysteries. ACS Symposium Series 886; Water-house, A., Kennedy, J. A., Eds.; American Chemical Society: Washington, DC, 2004; pp 68-88.

(48) Monagas, M.; Nuñez, V.; Bartolomé, B.; Gomez-Cordobes, C. Anthocyanin-derived pigments in Graciano, Tempranillo, and Cabernet Sauvignon wines produced in Spain. Am. J. Enol. Vitic. 2003, 54, 163–169.

(49) Schwartz, M.; Winterhalter, P. A novel synthetic route to substituted pyranoanthocyanins with unique color properties. Tetrahedron Lett. 2003, 44, 7583–7587.

(50) Schwartz, M.; Winterhalter, P. Novel aged anthoc-yanins from Pinotage wines: Isolation, characte-rization, and pathway of formation. In Red Wine Color. ReVealing the Mysteries. ACS Symposium Series 886; Waterhouse, A., Kennedy, J. A., Eds.; American Chemical Society: Washington, DC, 2004; pp 179- 197.

(51) Schwarz, M.; Hofmann, G.; Winterhalter, P. Inves-tigations on anthocyanins in wines from Vitis Vinifera cv. Pinotage: Factors influencing the for-mation of Pinotin A and its correlation with wine age. J. Agric. Food Chem. 2004, 52, 498–504.

(52) Salas, E.; Atanasova, V.; Poncet-Legrand, C.; Meu-dec, E.; Mazauric, J. P.; Cheynier, V. Demostra-tion of the occurence of flavonol-anthocyanin adducts in wine and in model disolutions. Anal. Chim. Acta 2004, 513, 325–332.

(53) Nikfardjam, M.; Dykes, S. I. Micro-oxygenation re-search at Lincoln University. Part 3: Polyphenolic analysis of Cabernet Sauvignon wines under the application of micro-oxygenation. Aust. NZ Gra-pegrower Winemaker 2003, 467, 41–44.

(54) Vidal, S.; Cartalade, D.; Souquet, J. M.; Fulcrand, H.; Cheynier, V. Changes in proanthocyanidin chain length in winelike model solutions. J. Agric. Food Chem. 2002, 50, 2261–2266.

(55) Cheynier, V.; Remy, S.; Fulcrand, H. Mechanisms of anthocyanin and tannin changes during wine-making and aging. In The ASEV 50th AnniVersary Annual Meeting; Rautz, J., Ed.; ASEV: Davis, CA, 2000; pp 337-344.

(56) Du Toit, W.; Marais, J.; Pretorius, I. S.; du Toit, M. Oxygen in must and wine: A review. S. Afr. J. Enol. Vitic. 2006, 57, 76–94.

(57) Du Toit, W.; Lisjak, K.; Marais, J.; du Toit, M. The effect of micro-oxygenation on the phenolic composi-tion, quality, and aerobic wine-spoilage microor-ganisms of different South African red wines. S. Afr. J. Enol. Vitic. 2006, 27, 57–67.

Received for review February 28, 2008. Revised manus-cript received May 9, 2008. Accepted May 9, 2008. This work was made possible by financial assistance from the Fundación Séneca (PB/31/FS/02).

102

Seminario Técnico


Efectos de la microoxigenación en vino tintoCano Lopez, M,; Fuentes Peralta, S.; Pardo Minguez, F.(1); López-Roca, J.M.; Gómez-Plaza, E

Departamento de Tecnología de Alimentos, Nutrición y Bromatología. Facultad de Veterinaria, Universidad de Murcia. Campus de Espinardo, 30071 Murcia

(1) Bodegas B.S.I. Ctra. Murcia, Jumilla, Murcia

Autor de contacto: e-mail: [email protected], tel. 968 367323

RESUMEN

La microoxigenación está basada en el aporte contro-lado de pequeñas cantidades de oxigeno de forma continua y lenta; siendo la velocidad del aporte de oxigeno inferior a la velocidad de su consumo, evi-tando la acumulación de oxigeno. El objetivo de esta técnica es favorecer la condensación entre taninos y antocianos y la formación de nuevos pigmentos; pro-porcionando así un incremento y estabilización del color del vino. Se ha estudiado el efecto de la técnica aplicando distintas dosis de oxigeno (dosis baja, me-dia y alta), a vinos de Monastrell. Los resultados obte-nidos muestran que la aplicación de oxigeno no afec-ta a la sanidad del vino. Los vinos microoxigenados presentan mayor intensidad colorante que el testigo. La tonalidad es similar en todos ellos, manifestando la mínima oxidación de polifenoles producida. Se des-taca el incremento de la fracción de color debido a pigmentos poliméricos, el índice de ionización y de PVPP en los vinos microoxigenados, presentando sus

valores máximos en el vino microoxigenado con dosis media. Estos parámetros muestran que se ha favore-cido la formación de nuevos pigmentos en los vinos. Por otro lado, el contenido de acetaldehído libre en los vinos microoxigenados es menor que en el testigo, manifestando que el acetaldehído generado forma parte de nuevos pigmentos, no interfiriendo en las características organolépticas de los vinos microoxi-genados. Al final del tratamiento se realizó un análisis organoléptico de los vinos, que junto a los resultados obtenidos se concluye que la dosis media resultó ser la mas adecuada al finalizar la microoxigenación.

INTRODUCCIÓN

Los compuestos fenólicos en un vino tinto determi-nan sus características sensoriales, principalmente el color y la astringencia. La composición fenólica de-pende de la composición de la uva, factores edafocli-máticos, procesos de vinificación y diferentes prácti-cas enológicas.

El oxigeno juega un papel importante en diversos procesos bioquímicos en los mostos y en los vinos, tanto durante la fermentación alcohólica como en las reacciones de oxidación y/o polimerización de com-puestos polifenólicos que se producen durante el envejecimiento del vino. Por ello, tradicionalmente se han efectuado aportes de oxigeno, bien mediante re-montados al inicio de la fermentación alcohólica; bien mediante trasiegos tras la fermentación alcohólica y fermentación maloláctica cuyo objetivo es eliminar y/o evitar la formación de compuestos sulfhídricos y retirar las lías gruesas (1).

Durante el envejecimiento del vino en barrica de ro-ble se produce la cesión de compuestos fenólicos y aromas propios de la madera al vino, además de una microoxigenación natural, al difundirse pequeñas can-tidades de oxígeno a través del esquive de la barrica,

Figura 1.- Estructura del polímero por condensación directa, A) tanino-antociano y B) compuesto bicíclico formado por la reacción entre el flavano y Mv-3Glu. (Remy et al. 2000).

Enólogos Efecto de la microoxigenación en vinos tintos. Enologos 34,46-50, 2005

Text

os a

soci

ados

103

Capítulo

entre las uniones de las duelas y los poros de la made-ra. Este oxigeno se ha demostrado que influye nota-blemente en la composición fenólica del vino, ya que interviene en reacciones de oxidación y/o polimeriza-ción, generando nuevos pigmentos que incrementan y estabilizan el color del vino (7,8,9,10,11,12,13,14, 15).

La generación de estos pigmentos sigue los siguien-tes mecanismos:

a) Reacciones de condensación directa entre an-tocianos (A) y taninos (T):

Los nuevos compuestos se forman mediante proce-sos de adición nucleofílica dando lugar a estructuras A+-T y T-A+. Han sido encontradas en vinos envejeci-dos (10, 16), ya que es una reacción lenta (17). Ambas estructuras son mas complejas que los antocianos monómeros, de color similar a los antocianos pero resistentes a la decoloración por SO

2, especialmente

la estuctura A+-T. La formación de estos compuestos genera una disminución de la astringencia de los vi-nos durante el envejecimiento (Figura 1).

b) Reacción de condensación mediante puentes de etilo.

En estas reacciones está involurado el acetaldehído, producto que aparece en el vino producido en peque-ñas cantidades por las levaduras durante el metabo-lismo de azúcares (18) y por la oxidación de etanol. El resultado son productos enlazados por puente de etilo, incluyendo taninos (T-etil-T), aductos de taninos-anto-cianos (T-etil-A) y oligómeros de antocianos (A-etil-A). La reacción de polimerización finaliza cuando en el otro extremo del polímero se encuentra unido un anto-ciano (20, 21). Su formación es más rápida que la de los pigmentos poliméricos por condensación directa (17).

La presencia de estos pigmentos produce incremento y estabilización del color del vino; su color es malva, son resistentes a las variaciones de pH, a la decolora-ción del sulfuroso y a las oxidaciones (19, 24), aunque se ha demostrado que su estabilidad en el tiempo es pequeña y evolucionan hacia otros tipos de com-puestos poliméricos (Figura 2).

Figura 2.- Compuestos formados en presencia de acetaldehído y de otros metabolitos de las levaduras. (Cheynier 2005).

104

Seminario Técnico


c) Nuevos pigmentos de bajo peso molecular.

Estos pigmentos se forman mediante la cicloadicón de metabolitos producidos por las levaduras, como el acetaldehído, ácido pirúvico o vinilfenoles, con el an-tociano, generando pigmentos como la Vitisina A y B y los antocianovinilfenoles. Han sido identificados en vinos envejecidos (8,9,12,13,15,22) en botella y en ba-rrica y en vinos microoxigenados (7). Son pigmentos ligeramente anaranjados, más resistentes a las varia-ciones de pH, al sulfuroso (9) y a las oxidaciones que los antocianos; estabilizando así el color del vino (12, 23) (Figura 3).

Debido a la importancia de la presencia de peque-ñas cantidades de oxígeno y de acetaldehído en la formación de estos pigmentos, nació en la década de los 90 la técnica de la microoxigenación, basada en el aporte controlado de pequeñas cantidades de oxigeno al vino mediante un microdifusor poroso, de forma continua y lenta, siendo la velocidad de aporte de oxigeno inferior a la velocidad de consumo, evi-tando la acumulación en vino y generando la máxima cantidad posible de este aldehído.

Determinadas experiencias han observado que tanto la crianza en barrica como la microoxigenación pro-ducen resultados similares en cuanto al incremento de color y disminución de astringencia, pudiendo con esta técnica reproducir, e incluso acelerar, parte de las transformaciones que sufren los compuestos fenólicos durante la crianza en barrica (3, 4). En este estudio se pretende conocer el efecto de esta técnica, aplicando distintas dosis de oxigeno, sobre el color de un vino tinto de la variedad Monastrell.

MATERIALES Y MÉTODOS

a) Condiciones de microoxigenación de los vinos

Para la experiencia de microoxigenación se ha utiliza-do un vino tinto de la variedad Monastrell, elaborado por Bodegas BSI de Jumilla (Murcia), que presentaba las siguientes características cromáticas iniciales: in-tensidad colorante (IC): 14.7, tono: 0.51, índice de polifenóles totales (IPT): 67.40 y antocianos totales: 443.63 mg/L

Tras la fermentación alcohólica el vino se dispuso en depósitos de 17.500L., uno de ello se utiliza como tes-tigo, en los otros se aplicó tres dosis diferentes de oxí-geno y en tres periodos distintos de la elaboración.

La adición de oxigeno se ha realizado durante tres pe-riodos:

- Durante dos semanas, entre el final de la fermen-tación alcohólica y el inicio de maloláctica, con do-sis aplicadas de 5, 10 y 15 mL/L/mes. La cantidad de oxigeno aplicada en este periodo, es la mas alta, para favorecer la generación de acetaldehído.

- Después de la fermentación maloláctica, durante un periodo de 45 días, las dosis aplicadas fueron 3, 5 y 7 mL/L/mes.

- Tras un análisis organoléptico de los vinos, se conti-nuó microxigenando 15 días más, suavizando los vi-nos microxigenados, aunque en este periodo las dosis en los tres casos se reduce a la mitad, puesto que el contenido de antocianos había descendido en todos los vinos.

La Figura 4 muestra un esquema del sistema de micro-oxigenación. Cada salida de oxigeno esta conectada a un microdifusor poroso que se encuentra suspendido en el interior del depósito sin llegar a tocar el fondo, de tal manera que las microburbujas se disuelvan en el vino antes de que lleguen a la superficie.

b) Determinaciones fisico-químicas y espectrofo-tométricas

El pH, la acidez total (g/L de ácido tartárico) y la acidez volátil se determinaron según los métodos oficiales.

Las medidas de absorbancia se realizan en un espec-trofotómetro Helios Alpha (Thermospectronic). Las muestras son centrifugadas y se ajustó el pH a 3.6. La intensidad de color (IC) se calculó como la suma de absorbancias a 620 nm, 520 nm y 420 nm; otras varia-bles calculadas son los porcentajes de rojo, amarillo y azul del color del vino (30). El tono como el coefi-ciente entre la absorbancia a 420 nm y 520 nm (25). El análisis del índice de polifenoles totales (IPT), an-tocianos totales y taninos totales (g/L), y los índices

Figura 3.- Estructura química Vitisina 1) A y 2) B. (Cheynier 2005).

Text

os a

soci

ados

105

Capítulo

de PVPP, ionización y HCl se efectuó siguiendo los métodos descritos por Ribereau-Gayon et al. (29). La fracción de color debida a los pigmentos poliméricos se calculó de acuerdo con los métodos descritos por Boulton (27).

RESULTADOS Y DISCUSIÓN

El Gráfico 1 muestra la evolución de pH, acidez total y acidez volátil durante la microoxigenación. Dichos pa-rámetros son similares en los vinos microoxigenados y el testigo, manifestando que el aporte de oxigeno no altera la sanidad del vino.

Se observa un incremento en la IC (Gráfico 2a) en el primer periodo de microoxigenación (Octubre-Di-ciembre/03) en los vinos microoxigenados. Tras la fer-mentación maloláctica (Enero/04) se observó en to-dos ellos un descenso, probablemente consecuencia de la variación del pH y la precipitación de materia co-loidal que arrastra materia colorante. Aunque el apor-te de oxigeno durante el segundo periodo fue menor, se observó de nuevo un aumento de IC en los vinos microoxigenados, diferenciándose todos los vinos en color. Este incremento de color en presencia de pe-queñas cantidades de oxigeno durante los primeros meses de la elaboración también ha sido encontrado por otros autores (3,5,6, ). Por otra parte, la evolución del tono, representado por el Gráfico 2b; es similar en los distintos vinos, indicando que los compuestos fe-nólicos sufren una mínima oxidación durante el tra-tamiento.

Mientras que la IC varió para los diferences vinos, el % rojo tras la microoxigenación (Gráfico 3) se mantuvo constante en todos los vinos; sugiriendo que ambos parámetros no están relacionados directamente, tal y como se ha indicado en otros trabajos (31,32), sino que la IC depende también de la absorbancia de los compuestos que aportan tonos amarillos y azules. El

Figura 4.- Esquema de la disposición del sistema de microoxigenación en el depósito.

SISTEMADEALIMENTACIÓN

BOMBONADE

OXÍGENO

MICRODIFUSOR

MANÓMETRO

Gráfico 1.- Evolución durante la microoxigenación de a) pH, b) acidez total y c) acidez volátil de los

vinos durante la microoxigenación.

106

Seminario Técnico


Gráfico 3 muestra la variación de la componente ama-rilla y azul en los vinos tras la microoxigenación. Se observa un incremento de la componente azul en los vinos microoxigenados, siendo máxima para el vino donde se aplicó la dosis media de oxígeno; mientras que la componente amarilla se mantiene constante en todos ellos excepto en el testigo. Estos resultados señalan la presencia de pigmentos poliméricos uni-dos mediante acetaldehído en los vinos microoxige-nados, ya que como propone Gómez-Cordovés et al. (23) existe una correlación directa con la componente azul y la polimerización de polifenóles.

El contenido de antocianos totales (Gráfico 4) descien-de por igual en todos los vinos durante la experiencia. El incremento de color y la disminución de antocianos totales en los vinos microoxigenados son datos apa-rentemente contradictorios, pero tiene su explicación cuando se analiza la evolución de la fracción de color debido a pigmentos poliméricos, como muestra el Gráfico 5. El color debido a los pigmentos poliméri-cos incrementa durante la aplicación de oxigeno, al igual que los resultados recogidos por Atanasova et al. (7). Su evolución es similar a la variación del color (Gráfico 2a), dicha relación también fue observada por Castellari et al. (6), presentando al finalizar la microoxi-genación su valor máximo en el vino con dosis media. El incremento de color en los vinos microoxigenados puede explicarse también mediante el análisis del índice de ionización y PVPP, como muestra el Gráfi-co 6. El índice de ionización indica el porcentaje de antocianos que presentan color en el vino. Los vinos microoxigenados presentan mayor valor que el testi-

go, de forma similar a los resultados encontrados por Cabanillas et al.(3). Finalizada la microoxigenación, el vino testigo sufre una disminución de este índice y su valor se incrementa en los vinos microoxigenado, poniéndose de manifiesto de esta forma la presencia de pigmentos coloreados formados mediante puente de acetaldehído y por cicloadición del aldehído a los antocianos. Siendo el índice de ionización máximo en el vino con dosis media de oxigeno.

Por otro lado, el índice de PVPP, que representa el por-centaje de antocianos combinados con taninos, nos da una idea del incremento y estabilidad del color, ya que estos compuestos presentan un color malva y son menos sensibles a las oxidaciones, a las varia-ciones pH y al sulfuroso que los antocianos libres. Su comportamiento es similar al índice de ionización, su valor es mayor en los vinos microxigenados, pero en el testigo disminuye tras el periodo de la microoxige-nación, de forma opuesta a lo que ocurre en los vinos microoxigenados, siendo máximo su valor en el vino con dosis media.

Gráfico 2.- Evolución de a) intensidad colorante (I.C.) y b) tono durante la microoxigenación.

Gráfico 3.- Variación al inicio y al final de la microoxigenación de los distintos vinos, % rojo, %

amarillo y % azul.

Text

os a

soci

ados

107

Capítulo

Gráfico 5.- Evolución de la fracción de color debido a pigmentos poliméricos.

Gráfico 7.- Evolución de A) IPT y B) taninos totales (g/L) de los vinos durante la microoxigenación.

Gráfico 6.- Índice de ionización y de PVPP en el vino inicial y en todos los vino tras la

microoxigenación.

Gráfico 4.- Evolución de antocianos totales (mg/L) de los vinos durante la microoxigenación.

Gráfico 8.- Índice de HCl finalizada la microoxigenación

Los Gráficos 7a y 7b muestran la evolución de IPT y taninos totales. Ambos parámetros son similares en todos los vinos; lo que indica que no se produce nin-guna precipitación de taninos durante la aplicación de esta técnica.

El análisis del contenido en taninos (procianidinas), representado por el Gráfico 7b, muestra que los ni-veles se mantiene durante la microoxigenación y es semejante en todos los vinos. No obstante, el índice de HCl, indicador del porcentaje de la polimerización de taninos presentes en vino; es superior en los vinos microoxigenados que en el testigo tras el periodo de microoxigenación (Gráfico 8), al igual que a Cabanillas

et al.(2001), presentando el máximo en el vino micro-oxigenado con la dosis media. Confirmando que la presencia de oxigeno favorece la polimerización de taninos, traduciéndose en una disminución de astrin-gencia.

Tras la microoxigenación se realizó el análisis organo-léptico de los vinos, concluyendo que:

- El vino testigo era ligeramente áspero en boca con taninos agresivos.

- Los vinos microoxigenados con dosis baja y media en boca eran redondos y con gusto agradable a mitad

108

Seminario Técnico


de boca. En nariz aparecía aroma afrutado y sin notas a reducción.

- El vino microoxigenado con dosis más altas en boca era similar a los otros dos vinos microoxigenados, aunque se apreciaban aromas a fruta madura y algo más evolucionado.

Concluyendo que organolépticamente las dosis más adecuadas son las dosis baja y media.

Teniendo en cuenta los resultados expuestos y el aná-lisis organoléptico de los diferentes vinos se concluye que la dosis adecuada durante la microoxigenación es la dosis media. Cabe esperar que estas diferencias sean mayores con el tiempo, haciendo interesante el seguimiento durante el envejecimiento en barrica y botella.

BIBLIOGRAFÍA

(1) Delteil D.(2000). Los diferentes roles del oxigeno. Viticultura/ Enología Profesional, 74, 35-45.

(2) Pérez- Magariño y Gozález San-José Mª L. (2003). Efectos de la aplicación de la microoxigenación durante la fermentación de los vinos tintos. Tec-nología del vino, 47, 107-112.

(3) Cabanillas P, Canals J.M., Rozés N., Arola L. Y Za-mora F.(2001) “ Influencia de la microoxigenación en el color y las características organolépticas de los vinos tintos” Tecnología del vino, Sept/Octu-bre 2001,51-55.

(4) Llaudy C., Canals R., Cabanillas P., Rozés N., Canals J.M. y Zamora F. (2004) Logroño “ Influencia de la microoxigenación en presencia y ausencia de lías sobre la composición en polifenoles y el color del vino; comparación con la crianza en barricas” IV Foro Mundial del vino 13-14 mayo 2004.

(5) González D.C., Herrera P., Fernández J.A., Sánchez M.,Pérez S., Ortega M., González M.L.(2003) Me-moria de Actividades de Investigación 2002/2003. Instituto Tecnológico Agrario de Castilla y León. Estación Enologíca 03.

(6) Castellari M., Matricardi l., Arfelli G., Galassi S., Amati A. (2000) “ Level of single bioactives phe-nolics in red wine as a function of the oxygen supplied during storage”, Food Chemistry 69,61-67.

(7) Atanasova V., Fulcrand H., Cheynier V., Moutonet M. (2002) “Effect of the oxigenation on polyphe-nol changes occurring in the course of wine-ma-king” Analitica Chimica Acta 458, 15-27.

(8) Wang H., Edward J.R., Shrikhande J. (2003). Antho-cyanin transformation in Cabernet Sauvignon Wine during Aging. J. Agric. Food Chem.,51,7989-7994.

(9) Bakker J. and Timberlake C.F. (1997). Isolation, Identification and Characterization of New Co-lor-Stable Anthocyanins Occuring in Some Red Wine. J. Agric. Food Chem.,45,35-47.

(10) Vivar- Quintana A.M., Santos-Buelga C., Rivas-Gonzalo J.C. (2002). Analytica Chimica Acta,458, 147-155.

(11) Mateus N. and Freitas V. (2001). Evolution and Sta-bility of Anthocyanin-Derived Pigments during Port Wine Aging. J. Agric. Food Chem.,49,5217-5322.

(12) Mateus N, Silva A.M.S., Vercauteren J., Freitas V.(2001). Occurrence of Anthocyanin- De-rived Pigments in Red Wines. J. Agric. Food Chem.,49,4936-4840.

(13) Mateus N., Pascual-Teresa S., Rivas-Gonzalo J.C., Santos Buelga C. (2002). Stuctural diversity of an-thocyanin-derived pigments in port wines. Food Chemistry,76, 335-342.

(14) Cameira-dos-Santos P.J., Brillouet J.M., Cheynier V, Moutounet M. (1996) Detection and Partial Cha-racterisation of New Anthocyanin- Derived Pig-ments in Wine. J. Agric. Food Chem.,70,204-208.

(15) Revilla I., Pérez-Magariño S., González-SanJosé M.L., Beltran S. (1999) Identification of anthoc-yanin derivatives in grape skin extracts and red wine by liquid chromatography with diode array and mass spectrometric detection. J. Chromato-gr. A, 847, 83-90.

(16) Remy S., Fulcrand H., Labarbe B., Cheynier V. (2000). First confirmation in red Wine of products resulting from direct anthocyanin-tannin reac-tions. J. Sci. Food Agric. 80, 745-751.

(17) Dallas C., Ricardo-da-Silva J., Laureano O. (1996).Products Formed in Model Wine Solutions invol-ving Anthocyanins, Procyanindin B2 , and Ace-taldhyde. J. Agric. Food Chem.,44, 2402-2407.

(18) Morata A., Gómez-Cordovés M.C., Colomo B., Suárez J.A.(2003). Pyryvic Acid

(19) Sims C.A. and Morris J.R. (1986) “Effects of acetal-dehyde and tannins on the color and chemical age of red Muscadine (Vitis Rotundifolia) Wine” Research Note JEV 37(2), 163-165.

Text

os a

soci

ados

109

Capítulo

(20) Es-Safin.E, Fulcrand H., Cheynier V., Mountounet M.(1999). Studies on the Acetaldhyde-Induced concensacion of (-)- epicatequina and Malvini-3 – Glucoside in a Model Solution system. J. Agric. Food Chem.,47,2096-2102.

(21) Es-Safin.E, Cheynier V., Mountounet M.(2002). Role of Aldehydic Derivates in the Condensa-tion of Phenolic Compounds with emphasis on the sensorial Propieties of fruit-derived foods. J. Agric. Food Chem.,50,5571-5585.

(22) Fancia- Aricha E.M., Guerra M.T., Rivas- Gonzalo J.C., Santos-Buelga C. (1997) ”New anthocyanin Pigments formed after condensation with flava-nols” J.Agric. Food Chem.,45,2262-2266.

(23) Sarni-Manchado P., Fulcrand H., Souquet JM., Cheynier V., Moutounet M.(1996). Stability and Color of unreported wine anthocyanin-derived Pigments. J.Food Science,61,938-941.

(24) Escribano-Bailon T., Álvarez-García M., Rivas-Gonzalo J., Heredia F.J., Santos-Buelga C.(2001). Color and Stabity of Pigments-Derived from Acethaldehido medianted condensation bet-ween Mv-3-O-Glu and (+)-catequin. J.Agric. Food Chem.,49,1213-1217.

(25) Sudraud P.(1958). Interpretationdes cour-bes dábsortion des vins rouges. An Technol Agric.,7,203-208.

(26) OIV (1990).Récueil des Méthodes Internationales dÁnalyse des vins et moûts. Office International de la Vigne et du Vin, Paris, Francia.

(27) Boulton R.B. (2001). The copigmentationof an-thocyanins and its role in the color in red wine: a critical review. Am. J. Enol. Vitic. 52, 67-87.

(28) Ribéreau-Gayon J, Peynaud E., Sudraud P., Ribé-reau-Gayon P. (1982) Traité dÓenologie. Sciences et Thechniques et du Vin.Tome I. Analise et con-trôle des Vins.Ed.Dunod. Paris. Francia.

(29) Ribéreau-Gayon P., Gories Y., Maujean A., Dubour-dieu D.(1998). Traité dÓenologie.2. Chimie du Vin. Stabilisation et traitaments. Editorial Dunod.

(30) Glories Y. (1978). Recherches sur la materie colo-rant des vins rouges. Thesis de la Universite de Bourdeaux, Université de Bourdeaux.

(31) Revilla I., González-SanJosé M.L. and Gómez Cor-dovés (1999). Modificaciones cromáticas del vino timto de crianza según el tipo de varrica en que envejece. Food Sci. Tech. Int., 5(2): 177-181.

(32) Pérez-Prieto L.J., De la Hera-Orts M.L., López Roca J.M., Fermandez-fernández J.I. y Gómez Plaza E. (2003). Oak-matured wines: Influence of the ca-racteristics of the barrel on wine colour and sen-sory characteristics. J. Sci. Food Agric., 83: 1445-1450.

(33) Gómez- Cordovés C and González-SanJosé M.L (1995). Interpretation of color Varibles during the aging of red wines: Relathionship with Families of phenolic compounds. J.Agric. Food Chem., 43(3): 557-561.

(34) Cheynier V. (2005). Polyphenols in foods are more complex than often thought. Am. J. Clin. Nutr., 81 (suppl): 223S-229S.

110

Modesto Lafuente 41-2º D28003 Madrid

[email protected]

Avd. de los Vinos s/n. Pol. Alces13600 Alcázar de San Juan (Ciudad Real)

Tel.: +34 926 55 02 00Fax.: +34 926 54 62 54

[email protected]

Seminario Técnico Compuestos azufrados volátiles en vinos · Seminario Técnico Compuestos...

Documents

Transcript of Seminario Técnico Compuestos azufrados volátiles en vinos · Seminario Técnico Compuestos...