Sin más por el momento y aprovechando para enviarle un ... Molina... · Licenciatura en Nutrición...

Dra. Anayansi Molina Hernández Técnico Académico Titular A Instituto de Fisiología Celular Departamento de Neurociencias U.N.A.M. [email protected]

México D. F. a 24 de Marzo del 2009. Dra. Laura Silva. PRESENTE Me dirijo a usted con el propósito de solicitar de la manera mas atenta para postularme como candidata para una de las plazas como Profesor Investigador, en el Departamento de Ingeniera Genética. CINVESTAV del IPN Unidad Irapuato (Cinvestav).

Cuento con la Maestría en Ciencias Fisiológicas y el Doctorado en la especialidad de Neurobiología Celular y Molecular, obtenidos en el Departamento de Fisiología Biofísica y Neurociencias del CINVESTAV, bajo la dirección del Dr. José Antonio Arias Montaño, en donde estudie aspectos farmacológicos de los receptores histaminérgicos H3 y el efecto de este sobre la síntesis y liberación de Glutamato y Dopamina en terminales nerviosas. Posteriormente, realice una estancia Posdoctoral en Paris Francia de dos años, en donde realice un estudio sobre el efecto de la histamina en la expresión de factores orexigénicos y anorexigénicos en neuronas de primer orden, que aun no ha sido publicado.

Actualmente me encuentro laborando como Técnico Titular Académico en el Instituto de Fisiología de la UNAM, colaborando en el Laboratorio del Dr. Iván Velasco, en donde además de realizar trabajo logístico y administrativo, tengo a mi cargo una alumna la cual fue graduada el año pasado como Bióloga y que actualmente esta realizando su Maestría en un proyecto relacionado con el efecto de la histamina sobre, la proliferación, diferenciación y muerte celular, propuesto por mi misma. Así mismo me encargo de guiar y discutir activamente con todos los alumnos del laboratorio. Por otro lado participe activamente en la escritura de dos de los proyectos sometidos y aceptados para la adquisición de recursos para CONACYT y PAPIIT. Además participo en la generación de los reportes de los proyectos con los que cuenta el laboratorio (CONACYT y PAPIIT).

A partir de este año fui promovida por el Sistema Nacional de Investigadores (SIN) al nivel I, después de haber sido candidato un periodo de 4 años.

Es de mi interés particular encontrar una Posición que me permita crecer como investigadora, para así poder continuar estudiando diversas funciones del sistema nervioso central en particular las del sistema histaminérgico en condiciones sanas y patológicas durante el desarrollo embrionario, así como su relación con otros sistemas.

Sin más por el momento y aprovechando para enviarle un cordial saludo me despido de usted esperando una respuesta positiva a esta solicitud.

Atentamente Dra. Anayansi Molina Hernández

CV Dra. Anayansi Molina Hernández

ANAYANSI MOLINA HERNÁNDEZ Nacionalidad Mexicana Fecha de Nacimiento Marzo 30, 1970 Lugar de Nacimiento México, Distrito Federal CURP MOHA700330MDFLRN03 Adscripción actual Instituto de Fisiología Celular (IFC-UNAM) Cargo actual Técnico Académico Titular A, PRIDE B. Sistema Nacional de Investigadores (SNI) SNI I Domicilio Académico Instituto de Fisiología Celular, UNAM. Departamento de Neurociencias, Lab. AL-101. Apartado Postal 70-600. Circuito Exterior s/n Ciudad Universitaria. Delegación Coyoacán 04510 México, D. F. Dirección electrónica [email protected]@yahoo.com.mx Teléfono trabajo +(0155) 56 22 56 49 IDIOMAS Español Lengua nativa Inglés Hablo, leo y escribo, nivel avanzado Francés Hablo y leo, nivel intermedio.

mailto:[email protected]


Dra. Anayansi Molina Hernández CV

FORMACIÓN ACADÉMICA Estancia Postdoctoral. Chercheur postdoctorale/Investigador Asociado Extranjero (Poste-Vert de l’INSERM). Unidad 573 del INSERM (Institut National de la Santé et de la Recherche Médicale en Francia), dirigido por el Dr. Pierre Sokolof. Centro Paul Broca del Hospital Sant Anne, Unidad de Neurobiología (Dr. Jean Michel Arrang) y Farmacología Molecular y la Facultad de Farmacia de la Universidad René Descartes Paris V (Dra. Anne Heron). Proyecto: Efecto de la histamina central sobre la regulación de factores orexigénicos y de saciedad en cerebro de roedores, el potencial terapéutico de los receptores histaminérgicos H3. 2002-2004. Doctorado en la especialidad de Neurobiología Celular y Molecular. Departamento de Fisiología, Biofísica y Neurociencias. Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV). México D. F. México. 2002. Tesis: REGULACIÓN POR RECEPTORES H3 DE LA SÍNTESIS DE DOPAMINA EN EL NEOESTRIADO DE LA RATA. Tutor: Dr. Antonio Arias Montaño Maestría en Ciencias Fisiológicas. Departamento de Fisiología, Biofísica y Neurociencias. Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV). México D. F. México. 1999. Tesis: REGULACIÓN POR LOS RECEPTORES H3 PARA HISTAMINA DE LA SÍNTESISDE DOPAMINA Y DE LA LIBERACIÓN DE GLUTAMATO EN EL SISTEMA NERVIOSO CENTRAL. Tutor: Dr. Antonio Arias Montaño Licenciatura en Nutrición y Ciencia de los alimentos. Universidad Iberoamericana. México D. F. México. 1999. Titulación por créditos de maestría. Proyecto: Niveles de serotonina cerebrales en ratas con diabetes insulino-dependiente. Dr. Jorge Hernández. PUBLICACIONES Revistas Científicas 1. Nidia S. Rodríguez-Rivera, Anayansi Molina-Hernández, Diana Escalante-Alcalde,

Iván Velasco. Activated Notch1 is a stronger astrocytic stimulus than Leukemia Inhibitory Factor for rat neural stem cells. I. J. Dev. Biol. Aceptado. doi: 10.1387/ijdb.092869nr. Factor de Impacto 2.830. Número de citas 0.

2. Molina-Hernández A., Velasco I. Histamine induces neural stem cell proliferation and

neuronal differentiation by activation of distinct histamine receptors. J. Neurochem. 106(2008):706-717. Factor de Impacto 4.451. Número de citas 0.

3. Néstor F Díaz, M. D., Ph. D.; Christian Guerra-Arraiza, Ph. D.; Néstor E Díaz-Martínez,

M. S.; Patricia Salazar, M. S.; Anayansi Molina-Hernández, Ph. D.; Ignacio Camacho-Arroyo, Ph. D.; Iván Velasco. Changes in the content of estrogen and progesterone receptors during differentiation of mouse embryonic stem cells to


dopamine neurons. Brain Research Bulletin. 73(2007):75–80. Factor de Impacto 1.943. Número de citas 2

4. Molina-Hernández A., Nuñez, A., Sierra J-J and Arias-Montaño J.A Histamine H3

receptor activation inhibits glutamate release from rat striatal synaptosomes. Neuropharmacology. 41(2001):928-934. Factor de Impacto 3.215. Número de citas 24.

5. Molina-Hernández A., Nuñez, A. and Arias-Montaño J.A. Histamine H3-receptor

activation inhibits dopamine synthesis in rat striatum. Neuroreport. 11 (2000):163-166. Factor de Impacto 2.163. Número de citas 27.

6. Manjarrez-Gutiérrez G., Herrera-Márquez J.R., Molina-Hernández A., Bueno-Santoyo

S., González-Ramírez M. and Hernández-R, J. Changes of brain serotonin synthesis in rat diabetes mellitus insulin-dependent. Rev Invest Clin. 51 (1999):293-302. Factor de Impacto 0.324. Número de citas 6.

Memorias en extenso 1. Molina-Hernández A., Velasco I. Histamine affects cell proliferation, apoptosis and

differentiation of cerebro cortical neural stem cells. JUN 1 2007. Developmental Biology. 306(1):392-393. Meeting Abstract: 277.

2. Molina-Hernández, A., A. Nuñez, J.A. Arias-Montaño (2001) Histamine H3 receptor

activation modulates glutamate release from rat striatal synaptosomes. En: T. Watanabe, H. Timmerman, K. Yanai (Editores) Histamine Research in the New Millenium. Elsevier Science, Amsterdam, pp. 455-456.

Revistas de divulgación científica 1. Iván Velasco, Emmanuel Díaz y Anayansi Molina. ¿Es posible usar la transferencia

nuclear seguida de extracción de células troncales embrionarias para el tratamiento de la enfermedad de Parkinson?. Gaceta Biomédicas, Junio de 2006, año 11, No.6.

Capítulos de Libros 1. A. Molina-Hernández, J. Ramos-Jiménez, J.-A. Arias-Montaño. Synaptosomes as a

model for the study of presynaptic events of chemical neurotransmission. En: L. Rocha, V. Granados-Soto (eds.), Methods in Neuropharmacology. Research Signpost, 2008 (En prensa).

2. Dr. Iván Velasco, Dra. Anayansi Molina-Hernández. Células Troncales del Sistema

Nervioso. Paginas 24-31. En: Biología Oral 4. Libro editado por Posgrado de la Facultad de Odontología. UNAM. 2008.

3. María de Lourdes Irigoyen Coria y Anayansi Molina Hernández. Capítulo X Esclerosis Múltiple. Páginas 271-279. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en

http://apps.isiknowledge.com/full_record.do?product=WOS&search_mode=GeneralSearch&qid=2&SID=2FnKCL9G@7D9IcLJo4j&page=1&doc=7

http://apps.isiknowledge.com/full_record.do?product=WOS&search_mode=GeneralSearch&qid=2&SID=2FnKCL9G@7D9IcLJo4j&page=1&doc=7


el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2006-2007. 3ª Edición Editorial Medicina Familiar Mexicana 2006-2007.

4. Anayansi Molina Hernández. Capítulo XI Enfermedades autoimunes y el sistema nervioso central. Páginas 281-290. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2006-2007. 3a Edición. Editorial Medicina Familiar Mexicana 2006-2007.

5. Anayansi Molina Hernández. Capítulo XIII Inmunonutrición. Páginas 301-310. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2006-2007. 3a Edición. Editorial Medicina Familiar Mexicana 2006-2007.

6. María de Lourdes Irigoyen Coria y Anayansi Molina Hernández. Capítulo X Esclerosis Múltiple. Páginas 263-273. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2005-2006. 2a Edición Editorial Medicina Familiar Mexicana 2005.

7. Anayansi Molina Hernández. Capítulo XI Enfermedades autoimunes y el sistema nervioso central. Páginas 274-284. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2005-2006. 2a Edición. Editorial Medicina Familiar Mexicana 2005.

8. María de Lourdes Irigoyen Coria y Anayansi Molina Hernández. Capítulo X Esclerosis Múltiple. Páginas 263-273. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2005. 1ª Edición Editorial Medicina Familiar Mexicana 2005.

9. Anayansi Molina Hernández. Capítulo XI Enfermedades autoimunes y el sistema nervioso central. Páginas 274-284. En: María de Lourdes Irigoyen Coria y Vilma Carolina Bekker Méndez. Guías para el Laboratorio de Inmunología. Actualidades en el Diagnóstico y Tratamiento de las Enfermedades Autoinmunes y Reumatológicas 2005. 1a Edición. Editorial Medicina Familiar Mexicana 2005.

TEMAS DE INVESTIGACIÓN A DESARROLLAR

• Factores que intervienen en el desarrollo del sistema nervioso central, en particular de la corteza cerebral y el mesencéfalo.

• Efecto de la histamina y su correlación con citocinas presentes durante el desarrollo, sobre la proliferación y diferenciación celular, utilizando modelos in vitro e in vivo del desarrollo del sistema nervioso central.


• Mecanismos de acción de la histamina durante el desarrollo del Sistema Nervioso Central.

• Farmacbiología Molecular de receptores Histaminérgicos durante el desarrollo. • Como afecta la diabetes tipo I y II materna al desarrollo del sistema nervioso

embrionario, postnatal y la etapa adulta.

EVALUACIÓN DE PROYECTOS 2009 Evaluación de 1 proyecto presentado en la Convocatoria de "CIENCIA BASICA 2008" del Fondo SEP – CONACYT. ACTIVIDAD PROFESIONAL Entrenamiento de alumnos de Licenciatura, Maestría y Doctorado para la realización de proyectos de Tesis. A partir de 2004. Estoy familiarizada con los sistemas de obtención de fondos para la investigación científica. Técnico Académico Titular A: En el Instituto de Fisiología Celular, Departamento de Neurociencias. Laboratorio del Dr. Iván Velasco Velázquez. Proyecto: El papel de la Histamina sobre la diferenciación de células madre neurales embrionarias y de adulto; El potencial neurogénico de la Histamina 2004-. Estancia en el laboratorio del Dr. Joshua Corbin para aprender la técnica de inyección de embriones utilizando un equipo de ultrasonido. “Children’s Research Institute, Center for Neuroscience Research, Children's National Medical Center” en Washington D.C. EUA. Del 6 al 20 de abril del 2007. Estancia en el laboratorio del Dr. Jesús Valdés. Departamento de Bioquímica del Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV). México D. F. México. El objetivo de la estancia fue la especialización en técnicas de Biología Molecular para su aplicación en proyectos de Farmacobiología. De mayo a agosto del 2002. Estancia el laboratorio del Dr. Carvalho. Center for Neurosciences of Coimbra, Department of Zoology, University of Coimbra, Portugal. El propósito de la estancia fue el aprendizaje de una técnica fluorométrica para evaluar la liberación de glutamato en preparaciones sinaptosomales. 1999 Estancia en el laboratorio de la Dra. María Eugenia Mendoza. Departamento de Fisiología, Biofísica y Neurociencias. Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV). El propósito de la estancia fue el aprendizaje de técnicas de cultivo de células de origen neuronal (neurohipófisis) y el aprendizaje de técnicas de estudio morfológicos. De marzo a julio de 1997. Estancia en el laboratorio del Dr. Jorge Hernández en el Departamento de Fisiología, Biofísica y Neurociencias del Centro de Investigación y de Estudios Avanzados del IPN (CINVEASTAV). Para realizar un proyecto sobre el efecto de la diabetes dependiente de


insulina sobre la síntesis de serotonina cerebral. El propósito de la estancia era realizar la tesis de licenciatura. De agosto 1994 a diciembre de 1995. MIEMBRO EN COMITES TUTORIALES Y EXÁMENES DE GRADO Como propietario en el examen de la alumna Itzel Escobedo Ávila con la tesis “Efecto de la histamina en la diferenciación de células troncales del mesencéfalo ventral”. 17 de abril del 2008. Comité tutorial de la Médico Alba Laura Vargas Ramírez inscrita al programa de Maestría en Biomedicina y Biotecnología Molecular de la Escuela Nacional de Ciencias Biológicas. Con la tesis Efectividad in vivo de la terapia fotodinámica y de modificación cromatínica en la eliminación de células de carcinoma cervicouterino. 26 de mayo del 2008. Comité tutoría de la Ana María Jiménez inscrita al programa de Maestría en Biomedicina y Biotecnología Molecular de la Escuela Nacional de Ciencias Biológicas. Con la tesis Efectividad in vivo de la terapia fotodinámica y de modificación cromatínica en la eliminación de células de carcinoma cervicouterino. 21 de Noviembre del 2008. AGRADECIMIENTOS FORMALES EN TESIS DE GRADO Universidad Nacional Autónoma de México. Tesis que para Obtener el grado Académico de Maestría en Ciencias. Maestra Nidia Samara Rodríguez Rivera. Maestría en Ciencias Bioquímicas, Facultad de Química. Tutor: Jaime Iván Velasco Velázquez. Septiembre 2008. Universidad Nacional Autónoma de México. Tesis que para Obtener el grado de Bióloga de la alumna Itzel Escobedo Ávila de la Facultad de Ciencias. Tutor: Jaime Iván Velasco Velázquez. Abril 2008. Universidad Nacional Autónoma de México. Tesis que para Obtener el grado de Maestría en Ciencias Bioquímicas. Maestro Philip Julian Knuckles Díaz. Tutor: Jaime Iván Velasco Velázquez. Marzo 2006. Universidad Nacional Autónoma de México. Tesis que para Obtener el Título de Bióloga. Lic. Nidia Samara Rodríguez Rivera. Tutor: Jaime Iván Velasco Velázquez. 2006. PRESENTACIONES EN CONGRESOS Nacionales 1. Sociedad Mexicana de Bioquímica, A. C. XXVI Congreso Nacional. La Histamina

Induce la Diferenciación Neuronal de Células Madre De LA Corteza Cerebral de la


Rata. Molina-Hernández A. y Velasco-Velázquez I. Guanajuato, Gto.-México. 12-17 de Noviembre del 2006 (póster).

2. Sociedad Mexicana de Biología del Desarrollo. VII Congreso Nacional. Efecto de la

histamina sobre las células madre del neuroepitelio de la rata. Molina-Hernández A. y Velasco-Velázquez I. Taxco, Guerrero-México. 11-13 de Noviembre del 2005 (póster).

3. Sociedad Mexicana de Ciencias Fisiológicas. XLV Congreso Nacional de Ciencias

Fisiológicas. La activación de receptores a histamina H3 inhibe la liberación de glutamato en sinaptosomas del hipocampo de la rata regulando canales de calcio activados por voltaje tipo N y P/Q. Molina-Hernández A., Sierra JJ y Arias-Montaño JA. Universidad de Colima, Colima, Colima-México. 8-12 de Septiembre del 2002 (presentación oral).

4. Sociedad Mexicana de Ciencias Fisiológicas. XLIV Congreso Nacional de Ciencias

Fisiológicas. La activación de receptores a histamina H3 inhibe la liberación de glutamato en sinaptosomas del neoestriado de la rata. Molina-Hernández A., Sierra JJ. y Arias-Montaño JA. Monterrey, Nuevo León-México. 26-30 de Agosto del 2001 (presentación oral).

5. 40 Aniversario CINVESTAV. Departamento de Fisiología, Biofísica y Neurociencias.

Reunión Académica Arturo Rosenblueth. Receptores para histamina en el SNC: Señalización y regulación de la función neural. A. Barbara, M. García, A. Hernández-Ángeles, A. Molina-Hernández, E. Sánchez-Lemus, L.E. Soria-Jaso y J.A. Arias-Montaño. 17-18 de Octubre del 2001, Auditorio del área Biológica, CINVESTAV, México D. F. México (póster).

6. Sociedad Mexicana de Ciencias Fisiológicas. XLII Congreso Nacional de Ciencias

Fisiológicas. La activación de receptores H3 para histamina inhibe la síntesis de dopamina en el neoestriado de la rata. Molina-Hernández A., Limón D., Nuñez A. y Arias-Montaño JA. Zacatecas, Zacatecas-México. 26-30 de Septiembre del 1999 (presentación oral).

Internacionales 1. XXXVI Meeting of European Histamine Research Society. Effect of histamine on cell

proliferation, apoptotic death and cell differentiation in cultured cortical neural stem cells, on the way to study the histaminergic role during cerebral cortex development. A. Molina-Hernández, I. Velasco. Del 9 al 12 de Mayo del 2007. Florencia, Italia (poster).

2. First Panamerican Congress in developmental Biology, SCB 66th Annual Meeting,

SMBD 8th Annual Meeting and LASDB 3rd International Meeting. Histamine affects cell proliferation, apoptosis and differentiation of cerebro cortical neural stem cells. Anayansi Molina Hernández, Iván Velasco. Del 16 al 20 de junio del 2007. Cancún, México (poster).

3. 5th Annual Meeting of the International Society for Stem Cell Research. Changes in

the content of estrogen alpha and progesterone receptors during differentiation of mouse embryonic stem cells to dopamine neurons. Díaz Néstor*, Guerra-Arraiza


Cristian, Molina Anayansi, Salazar Patricia, Camacho-Arroyo Ignacio, Velasco Iván. Del 17 al 20 de junio del 2007. Cairns, Australia (poster).

4. 36th Annual Meeting, Society for Neuroscience 2006. Histamine induces neuronal

differentiation and modify histaminergic receptors expression in cultured neural stem cells. Molina-Hernández A., Velasco I. Del 14 al 18 de Octubre del 2006. Atlanta, Georgia. E.U.A. (poster).

5. International Sendai Histamine Symposium. Histamine H3-receptor activation

modulates glutamate release from rat striatal synaptosomes. A. Molina-Hernández, D. Limón, A. Nuñez and J.A. Arias-Montaño. Del 22 al 25 de noviembre del 2000. Sendai, Japón (póster).

6. 30th Annual Meeting, Society for Neuroscience. Histamine H3-receptor activation

inhibits glutamate release from rat striatal synaptosomes. Molina-Hernández A., A. Nuñez and J.A. Arias-Montaño. Del 4 al 9 de noviembre del 2000. New Orleans, LA. E. U. A. (poster)

7. 29th Annual Meeting, Society for Neuroscience. Histamine H3-receptor activation

inhibits Dopamine synthesis in rat striatum. A. Molina-Hernández, D. Limón, A. Nuñez and J.A. Arias-Montaño. Del 23 al 28 de Octubre de 1999. Miami, Fla. E. U. A. (poster).

DOCENCIA Y CONFERENCIAS 2009 Conferencia dentro del Seminario Departamental. IPN-Escuela Nacional de Medicina y Homeopatía. Programa de Maestría y Doctorado en Biomedicina Molecular “Papel de la histamina en el desarrollo de la corteza cerebral: Estudio In Vitro”. Marzo. 2008 Profesora Invitada en el curso de Posgrado de la Escuela Nacional de Ciencias Biológicas (IPN). “Cultivo de Células y Tejidos (animales)” con el tema “Manejo, cultivo y Aplicación de las Stem Cells”. 5 de Noviembre. Conferencia “Posible Papel de la Histamina en el Desarrollo de la corteza Cerebral: un acercamiento in vitro”. Seminario del Programa de Posgrado en Biomedicina y Biotecnología Molecular del IPN-Escuela Superior de Ciencias Biológicas. 29 de Octubre. Conferencia “La Histamina y las Células Troncales Neurales”. Universidad Simón Bolívar, Licenciatura de Biología de la Universidad Simón Bolívar. 18 de Octubre. Profesora invitada en el curso de posgrado “Neuroquímica Básica”. “La Histamina”. UNAM-Instituto de Fisiología Celular. Programa de Doctorado directo en Ciencias Biomédicas. 2 de Octubre.


Profesora invitada en el Curso Monográfico de Biología Molecular. “Biología Molecular en Neurociencias”. Instituto Mexicano del Seguro Social. UMAE. Hospital de Infectología Dr. Daniel Méndez Hernández. Centro Medico La Raza. 30 de Mayo. Profesora Invitada en el curso de Posgrado de la Escuela Nacional de Ciencias Biológicas (IPN). “Cultivo de Células y Tejidos (animales)” con el tema “Manejo, cultivo y Aplicación de las Stem Cells”. 28 de Mayo. Profesora invitada en el curso de Posgrado “Estructura y Función de la Célula”. “Transducción de Señales”. IPN-Escuela Nacional de Medicina y Homeopatía. Programa de Maestría y Doctorado en Biomedicina Molecular. 19 de Febrero. 2007 Profesora Invitada en el curso de Posgrado de la Escuela Nacional de Ciencias Biológicas (IPN). “Cultivo de Células y Tejidos (animales)” con el tema “Manejo, cultivo y Aplicación de las Stem Cells”. 7 Noviembre. Profesora invitada en el curso de Posgrado “Estructura y Función de la Célula”. “Transducción de Señales”. IPN-Escuela Nacional de Medicina y Homeopatía. Programa de Maestría y Doctorado en Biomedicina Molecular. Del 1 al 26 de Octubre. Profesora invitada en el curso de Posgrado “Neuroquímica Básica”. “La Histamina”. UNAM-Instituto de Fisiología Celular. Programa de Doctorado directo en Ciencias Biomédicas. 11 de Octubre. Profesora invitada en el Curso Monográfico de Biología Molecular. “Biología Molecular en Neurociencias”. Instituto Mexicano del Seguro Social. UMAE. Hospital de Infectología Dr. Daniel Méndez Hernández. Centro Medico La Raza. 31 de Octubre y 30 de Mayo. Profesora Invitada en el curso de Licenciatura de la Escuela Nacional de Ciencias Biológicas (IPN). “Cultivo de Células y Tejidos (animales)” con el tema Manejo, cultivo y Aplicación de las Stem Cells”. 23 Mayo. Conferencia “La Histamina y su Posible Importancia Durante el Desarrollo del Sistema Nervioso Central”. Seminario del Departamento de Farmacología Cinvestav, Sede Sur. 25 de Abril. 2006 Profesora Invitada en el curso de Licenciatura de la Escuela Nacional de Ciencias Biológicas (IPN). “Cultivo de Células y Tejidos (animales)” con el tema Aplicaciones de las Stem Cells Neuronales. 23 de Noviembre. Profesora invitada en el curso de Posgrado “Neuroquímica Básica”. “La Histamina”. UNAM-Instituto de Celular. Programa de Doctorado directo en Ciencias Biomédicas. 20 de Octubre.


Profesora invitada en el Curso de Biología Molecular. “Biología Molecular en las Neurociencias”. Instituto Mexicano del Seguro Social. UMAE. Hospital de Infectología Dr. Daniel Méndez Hernández. Centro Medico La Raza. Junio. Profesora invitada en el curso de Biología Molecular. “Biología Molecular en las Neurociencias”. Instituto Mexicano del Seguro Social. UMAE. Hospital de Infectología Dr. Daniel Méndez Hernández. Centro Medico La Raza. Mayo. Profesora invitada en el Curso de Neurobiología. “Uso Terapéutico de las Células Madre en enfermedades Neurodegenerativas”. Universidad Simón Bolívar. Impartida en la Licenciatura de Biología. Mayo. 2005 Profesora invitada en el Curso de Biología Molecular. “Biología Molecular Aplicada en las Neurociencias”. Instituto Mexicano del Seguro Social. Hospital de Infectología Dr. Daniel Méndez Hernández. Centro Medico La Raza. Junio. 1998 Profesora invitada en el Curso de Fisiología de sistema nervioso impartido a los alumnos de la 20ava. Generación de Medicina del 22 de junio al 4 de julio de 1998 en el Centro Interdisciplinario de Ciencias de la Salud-IPN. BECAS Y DISTINCIONES Mención Honorífica otorgada por el poster presentado en el concurso de posters en la XXXVI reunión de la Sociedad Europea de Investigación en Histamina. Florencia, Italia 12 de Mayo del 2007. Reconocimiento otorgado por la Facultad de estudios superiores Zaragoza. Departamento de educación continua. Por participar como profesor en el curso de Biología Molecular con el tema Biología Molecular en Neurociencias. Organizado por el Hospital de Infectología CMN La Raza el 25 de mayo y 27 de junio del 2006. Becaria de la Unité de Neurobiologie et Pharmacologie Moléculaire (INSERM, unidad 573) Centro Paul Broca (Paris Francia) 2003-2004. Becaria del programa Poste-Vert de l’INSERM, Institut National de la Santé et de la Recherche Médicale en Francia. 2002-2003. Becaria del CONACyT (Consejo Nacional para la Ciencia y la Tecnología) para realizar estancia post-doctoral en la Unidad de Neurobiología y Farmacología Molecular (U573) del Centro Paul Broca del Instituto Nacional para la Investigación Médica (INSERM), Paris. Francia. 2002-2003. Becaria de la por la Secretaria Académica del Centro de Investigación y Estudios Avanzados del IPN. México D. F. México. 2002, terminación de tesis doctoral.


Becaria del CONACyT (Consejo Nacional para la Ciencia y la Tecnología) para realizar estudios de Maestría y Doctorado en el CINVESTAV-IPN (Centro de Investigación y de Estudios Avanzados del IPN). México D. F. México. 1997-2002. Reconocimiento por un excelente trabajo de Titulación para obtener el grado de Licenciatura en Nutrición y Ciencia de los Alimentos, 1999. Universidad Iberoamericana. México D. F. CONSTANCIAS Curso “Introduction to Human Embryonic Stem Cell culture Methods”. Impartido del 16 al 18 de abril del 2007 en las instalaciones del WiCell Reasearch Institute. Madison, WI. E.U.A. Curso de Seguridad en el Manejo de Gases. INFRA S.A. de C.V. Impartido el 23 de Noviembre del 2005 en las instalaciones del Instituto de Fisiología Celular-UNAM. Por estancia para el aprendizaje de una técnica fluorométrica para evaluar la liberación de glutamato en preparaciones sinaptosomales en el Centro de Neurociencias e Biología Celular. Universidad de Coimbra. Coimbra. Portugal. Curso de Radioactividad impartido por Control de Radiaciones e Ingeniería, S.A. de C.V. y el Centro de Investigación y de Estudios Avanzados del IPN. “Seguridad Radiológica en Investigación para Personal Ocupacionalmente Expuesto”. Impartido del 24 al 28 de Agosto de 1998. En las instalaciones del CINVESTAV-IPN. Duración 30 horas, México D. F. México. Curso de Nutrición Infantil. La Sociedad de Nutriología A. C. Del 9 al 11 de febrero de 1994. Instituto Nacional de Perinatología, México D. F. Curso de Conceptos Básicos de Alimentación Enteral y Endovenosa. Asociación Mexicana de Alimentación Enteral y Endovenosa. Del 3 al 5 de marzo de 1993. Universidad Iberoamericana. México D. F. Simposio Internacional, “Brain Plasticity Development and Aging”. Universidad Autónoma de Querétaro. 3 de diciembre de 1993. Universidad Autónoma de Querétaro, Auditorio Fernando Díaz Ramírez. Querétaro. México. Quinto Simposio de Nutrición y alimentos, Constancia de asistencia. La Sociedad de Nutriología A. C. Del 10 al 14 de febrero de 1992. Instituto Nacional de Pediatría, México D. F. Cuarto Simposio de Nutrición y alimentos, Constancia de asistencia. La Sociedad de Nutriología A. C. Del 22 al 26 de abril de 1991. Universidad Iberoamericana. México D. F. Semana de Nutrición y Alimentos. Universidad Iberoamericana. 13 de Noviembre de 1991. Tercer Simposio de Nutrición y alimentos, Constancia de asistencia. La Sociedad de Exalumnos de Ciencias de la Nutrición y de los Alimentos y La Universidad


Iberoamericana Del 26 al 30 de marzo de 1990. Instituto Nacional de la Nutrición. Salvador Zubirán Universidad Iberoamericana. México D. F.

Marzo 2009.

Neuropharmacology 41 (2001) 928–934www.elsevier.com/locate/neuropharm

Histamine H3 receptor activation inhibits glutamate release fromrat striatal synaptosomes

Anayansi Molina-Herna´ndez, Alejandro Nun˜ez, Juan-Jose´ Sierra, Jose´-AntonioArias-Montano *

Departamento de Fisiologıa, Biofısica y Neurociencias, Centro de Investigacion y de Estudios Avanzados, Apdo. postal 14-740, 07000 Mexico,D.F., Mexico

Received 31 January 2001; received in revised form 21 August 2001; accepted 4 September 2001

Abstract

The release of glutamate from striatal synaptosomes induced by depolarisation with 4-aminopyridine (4-AP) was studied by amethod based on the fluorescent properties of the NAPDH formed by the metabolism of the neurotransmitter by glutamate dehydro-genase.

Ca2+-dependent, depolarisation-induced glutamate release was inhibited in a concentration-dependent manner by the selectivehistamine H3 agonist immepip. Best-fit estimates were: maximum inhibition 60±10% and IC50 68±10 nM. The effect of 300 nMimmepip on depolarisation-evoked glutamate release was reversed by the selective H3 antagonist thioperamide in a concentration-dependent manner (EC50 23 nM, Ki 4 nM).

In fura-2-loaded synaptosomes, the increase in the intracellular concentration of Ca2+ ([Ca2+]i) evoked by 4-AP-induced depolaris-ation (resting level 167±14 nM; �[Ca2+]i 88±15 nM) was modestly, but significantly reduced (29±5% inhibition) by 300 nMimmepip. The action of the H3 agonist on depolarisation-induced changes in [Ca2+]i was reversed by 100 nM thioperamide.

Taken together, our results indicate that histamine modulates the release of glutamate from corticostriatal nerve terminals. Inhi-bition of depolarisation-induced Ca2+ entry through voltage-dependent Ca2+ channels appears to account for the effect of H3 receptoractivation on neurotransmitter release. Modulation of glutamatergic transmission in rat striatum may have important consequencesfor the function of basal ganglia and therefore for the control of motor behaviour. 2001 Elsevier Science Ltd. All rights reserved.

Keywords: Histamine H3 receptor; Striatum; Glutamate; Basal ganglia

1. Introduction

Histamine is a neuromodulator in the mammalian cen-tral nervous system, where it regulates, via both pre- andpost-synaptic mechanisms, a variety of central responsesand functions, such as wakefulness, feeding, drinking,the neuroendocrine system, body temperature, analgesiaand motor activity (Wada et al., 1991; Schwartz et al.,1991; Onodera et al., 1994). The cell bodies of hista-minergic neurones are located in the hypothalamus, fromwhere they send diffuse projections to almost all brainregions (Wada et al., 1991). The actions of histamine are

* Corresponding author. Tel.:+525-7-473-800x5137, 5150; fax:+525-7-477-105.

E-mail address: [email protected] (J.-A. Arias-Montano).

0028-3908/01/$ - see front matter 2001 Elsevier Science Ltd. All rights reserved.PII: S0028-3908 (01)00144-7

mediated by three well-defined receptors (H1, H2 andH3), characterised by their pharmacology and signaltransduction mechanisms (Hill et al., 1997), although themolecular cloning of a fourth histamine receptor wasrecently reported (Oda et al., 2000; Liu et al., 2001;Nguyen et al., 2001; Zhu et al., 2001).

Histamine H3 receptors in the CNS appear to bepresent primarily on nerve terminals, where they regulatethe release of histamine itself and of other neuro-transmitters, such as acetylcholine, dopamine, noradren-aline and 5-hydroxytryptamine (Hill et al., 1997). In thestriatum, which has the highest density of H3 receptorsin both human and rat brain (Martı´nez-Mir et al., 1990;Cumming et al., 1991; Pollard et al., 1993), and in thesubstantia nigra pars reticulata, lesioning studies haveshown that these receptors are present predominantly onthe GABAergic projection neurones (Pollard et al., 1993;

929A. Molina-Hernandez et al. / Neuropharmacology 41 (2001) 928–934

Ryu et al., 1994). In both the striatum and the substantianigra H3 receptor activation leads to a marked and selec-tive inhibition of the component of depolarisation-induced release of γ-aminobutyric acid (GABA) that isdependent on concomitant D1 receptor stimulation(Garcıa et al., 1997; Arias-Montano et al., 2001). Thisaction in the basal ganglia, a group of subcortical nucleiintimately involved in the control of movement (Gerfenand Wilson, 1996), suggests that histamine might havean important role in disorders of motor control.

Nigrostriatal (dopaminergic) and corticostriatal(glutamatergic) pathways (Gerfen and Wilson, 1996)provide the major synaptic inputs to the striatum. Wehave recently shown that striatal synaptosomes areendowed with H3 receptors (Molina-Hernandez et al.,2000a) and selective lesioning of dopaminergic neuroneswith 6-hydroxydopamine indicates that a minor fraction(�20%) of presynaptic H3 receptors are located on nigro-striatal terminals, where they appear to modulate dopam-ine synthesis (Molina-Hernandez et al., 2000a) andrelease (Schlicker et al., 1993). However, Doreulee et al.(2001) have recently shown that in rat striatum H3 recep-tor activation depresses the amplitude of extracellularfield potentials evoked by corticostriatal stimulation.This suggests that a significant fraction of striatal H3

receptors could be located on corticostriatal afferents andregulate glutamate release. We provide here direct evi-dence for H3 receptor-mediated inhibition of glutamaterelease from isolated striatal nerve terminals. A prelimi-nary account of some of these results has been presentedto the Society for Neuroscience (Molina-Hernandez etal., 2000b).

2. Methods

2.1. Animals

Male adult rats (250–300 g), Wistar strain, bred in theCINVESTAV facility, were used throughout. All effortswere made to minimise animal suffering, to use only asmany animals were required for proper statistical analy-sis, and to seek alternatives to in vivo techniques.

2.2. Synaptosome preparation

Synaptosomes were prepared using a modification ofthe method of Gray and Whittaker (1962). Briefly, ani-mals were killed by decapitation, the brain was rapidlyremoved from the skull and the striata were dissectedout. Nuclei were placed in 15 ml 0.32 M sucrose/5 mMTris–HCl (pH 7.4) and homogenised using 12 strokes ofa hand-held homogeniser. The homogenate was centri-fuged at 800g for 10 min at 4°C and the supernatant wascollected, brought up to 25 ml with 0.32 M sucrose/5mM Tris–HCl and centrifuged at 20,000g for 20 min.

The resultant pellet was resuspended in 7 ml 0.32 Msucrose/5 mM Tris–HCl, layered onto 20 ml of 0.8 Msucrose/5 mM Tris–HCl and centrifuged at 20,000g for20 min. The final pellet was gently resuspended (0.6–1mg protein/ml; Lowry et al., 1951) in 0.32 sucrose/5 mMTris–HCl and 1 ml aliquots were centrifuged at 13,000gfor 1 min (Eppendorf microcentrifuge). Pellets were kepton ice until use (�3 h).

2.3. Glutamate release assay

Glutamate release from striatal synaptosomes wasassayed using the method of Nicholls et al. (1987), basedon the fluorescent properties of NAPDH formed fromNADP+ by the metabolism of glutamate by glutamatedehydrogenase. Pelleted synaptosomes were resus-pended in 1 ml HEPES-buffered medium (HBM) con-taining 1 mg/ml albumin (fatty acid-free) and incubatedat 37°C. After 30 min synaptosomes were centrifuged at13,000g for 20 s and the pellet was resuspended in 2 mlHBM containing 50 U/ml glutamate dehydrogenase, 1mM NADP+ and 1.8 mM CaCl2 (except for determi-nations of the Ca2+-dependence of release, for whichCaCl2 was omitted). This synaptosomal suspension wasplaced in a constantly-stirred, thermostated (37°C)quartz cuvette in a Perkin Elmer LB50B spectrofluori-meter and preincubated for 5 min before basal releasewas estimated. Glutamate release was evoked by adding10 µl 4-aminopyridine (4-AP; 4 mM finalconcentration). The conversion of NADP+ to NADPHwas followed at excitation and emission wavelengths of340 and 460 nm respectively. Immepip was added 5 minbefore depolarisation with 4-AP. When required, thiop-eramide was added 5 min before immepip. The compo-sition of the HBM was (in mM): NaCl 127, KCl 3.7,MgSO4 1.2, KH2PO4 1.2, D-glucose 11, HEPES 20; pH7.4 with NaOH.

In each experiment a concentration–fluorescencecurve for glutamate (1–4 µM) was established bysequentially adding 2-nmol aliquots of L-glutamate tosynaptosomal suspensions (2 ml). Protein contents weredetermined and these data were used to convert fluor-escence data to nmol glutamate/mg protein. Ca2+-inde-pendent release was subtracted from total release to givea measure of Ca2+-dependent glutamate release in eachexperiment.

2.4. Determination of intracellular Ca2+ ([Ca2+]i)

Synaptosomes were resuspended in 5 ml HBM con-taining 1.8 mM CaCl2, 5 µM fura 2-acetomethylester(fura2-AM) and 1 mg/ml bovine serum albumin, andincubated for 60 min (37°C) in the dark. Aliquots (340–420 µg protein) were then centrifuged (1 min, 15,000g).The pellet was resuspended in 2 ml HBM (1.8 mMCaCl2) and transferred to a plastic cuvette, which was

930 A. Molina-Hernandez et al. / Neuropharmacology 41 (2001) 928–934

placed in the warmed chamber of a Perkin Elmer LB50Bspectrofluorimeter. UV excitation was set at 340 and 380nm and the emission was monitored at 510 nm. Intra-cellular free Ca2+ was estimated according to the follow-ing equation (Grynkiewicz et al., 1985):

[Ca2+]i�KD·f(R�Rmin/Rmax�R)

where R is the fluorescence ratio (F340 nm/F380 nm), f isthe fluorescence ratio (380 nM) of free and Ca2+-boundfura 2 and KD is the dissociation constant of fura 2 forCa2+ ions (224 nM). Values for Rmax and Rmin weredetermined for each sample. Rmax is the fluorescence inthe presence of Triton X-100 (1% in 3 M Tris–HCl, pH8) and Rmin is the fluorescence remaining after theaddition of EGTA (final concentration 5 mM). Depolar-isation was evoked by adding 10 µl 4-AP (4 mM finalconcentration). Drugs under test were added 5 minbefore 4-AP.

2.5. Analysis of data

All data are expressed as means±SE mean (SEM).Concentration–response data were fitted by non-linearregression to a four-parameter logistic equation using theprogram Prism (Graph Pad Software, San Diego, CA).The inhibition constant (Ki) for thioperamide in revers-ing the inhibition by immepip was calculated from thecurves for immepip and thioperamide according to theCheng–Prusoff equation (Cheng and Prusoff, 1973;Craig, 1993).

2.6. Materials

Glutamate dehydrogenase (type II from bovine liver,39 U/mg protein), bovine albumin (fraction V, fatty acid-free) and β-nicotinamide adenine dinucleotide (β-NADP+ sodium salt) were purchased from Sigma (StLouis, MO, USA). Fura 2-AM was from MolecularProbes (Eugene, OR, USA). Thioperamide maleate andL-glutamic acid HCl were from RBI (Natick, MA,USA). Immepip dihydrobromide was a kind gift fromDr R. Leurs and Prof. H. Timmerman (Vrije Universit-eit, Amsterdam).

3. Results

3.1. Glutamate release from striatal synaptosomes

3.1.1. Characteristics of releaseBasal glutamate release was 0.46±0.04 nmol/mg pro-

tein (means±SEM from the combined values from 15experiments). Addition of 4 mM 4-AP in the presence of1.8 mM Ca2+ caused a significant increase in glutamaterelease and experiments in which Ca2+ ions were omitted

from the incubation medium showed that 67±7% of 4-AP-stimulated release was Ca2+-dependent (7.1±0.4nmol/mg protein). In subsequent experiments the Ca2+-independent component of 4-AP-stimulated release wassubtracted from total glutamate release.

3.1.2. Effect of H3 receptor activationThe Ca2+-dependent release of glutamate evoked by

depolarisation with 4-AP was inhibited in a concen-tration-dependent manner by the selective H3 agonistimmepip (Fig. 1). Best-fit estimates yielded a maximuminhibition of 60±10%, IC50 68±10 nM and Hill coef-ficient, nH, 1.4±0.3 (n=4). In medium with no added Ca2+

Fig. 1. Effect of H3 receptor activation on Ca2+-dependent, depolaris-ation-evoked glutamate release. Striatal synaptosomes were incubatedwith glutamate dehydrogenase (50 U/ml) and NADP+ (1 mM) asdescribed in Methods before glutamate release was evoked by 4-AP(4 mM, vertical arrow). Drugs under test were present 5 min beforedepolarisation. Ca2+-independent glutamate release, which was determ-ined in each experiment, has been subtracted. Fluorescence valueswere converted into nmol of glutamate by means of calibration curvesdetermined at the beginning and the end of each experiment. (A)Immepip inhibition of glutamate release. A representative experimentis depicted. (B) Concentration–response curve for immepip. To allowfor variations between experiments, glutamate release is expressed aspercentage of control values. Data are mean±SEM from the combinedvalues from four experiments with 2–3 replicates for each condition.The curve drawn is the best-fit line to a logistic (Hill) equation. Best-fit estimates are given in the text.


immepip (1 µM) had no effect on depolarisation-evokedglutamate release (data not shown).

The effect of 300 nM immepip on depolarisation-evoked glutamate release (53±11% inhibition, Fig. 2)was reversed by the selective H3 antagonist thioperamidein a concentration-dependent manner (EC50 23 nM, Ki 4nM). Fig. 2 also shows that thioperamide on its own hadno significant effect on depolarisation-evoked release.

3.1.3. Effect of H3 receptor activation ondepolarisation-evoked changes in [Ca2+]i

In fura 2-loaded striatal synaptosomes resting [Ca2+]i

levels were 167±14 nM (means±SEM from sevenexperiments) and depolarisation with 4 mM 4-APresulted in a significant increase in [Ca2+]i (�[Ca2+]i

88±15 nM). The increase in [Ca2+]i induced by depolar-isation was modestly, but significantly reduced

Fig. 2. Reversal by thioperamide of the inhibitory action of immepipon Ca2+-dependent, depolarisation-evoked glutamate release. (A) Rep-resentative trace of the effect of 300 nM immepip and reversal by100 nM thioperamide. Glutamate release was evoked by 4-AP (4 mM,vertical arrow) and drugs under test were present 5 min (immepip)or 10 min (thioperamide) before depolarisation. (B) Analysis of thecombined data (mean±SEM) from four experiments with 2–3 replicatesfor each condition. To allow for variations between experiments, gluta-mate release is expressed as percentage of control values. The curvedrawn is the best-fit line to a logistic (Hill) equation. The best-fit EC50

estimate and the Ki value obtained are given in the text.

(29±5% inhibition, P�0.05) by 300 nM immepip (Fig.3). The effect of the H3 agonist on 4-AP-inducedchanges in [Ca2+]i was reversed by 100 nM thioperam-ide. Fig. 3 also shows that the H3 antagonist had no sig-nificant effect on its own on the depolarisation-evokedrise in [Ca2+]i.

4. Discussion

Besides being located on histaminergic nerve ter-minals where they regulate the synthesis and release ofhistamine, H3 receptors are found as heteroreceptors thatpresynaptically inhibit the release of noradrenaline, 5-

Fig. 3. Effect of H3 receptor activation on depolarisation-inducedchanges in [Ca2+]i in fura 2-loaded striatal synaptosomes. (A) Effectof immepip and reversal by thioperamide. Depolarisation was inducedwith 4 mM 4-AP (vertical arrows). A representative experiment isdepicted. (B) Analysis of the combined data (mean±SEM) from fourexperiments with duplicates for each condition. To allow for variationsbetween experiments, changes in [Ca2+]i are expressed as percentageof control values. thiop., thioperamide. aP�0.05 versus control; bnotsignificantly different from control (ANOVA followed by Student–Newman–Keuls test).


hydroxytryptamine, dopamine and GABA (Hill et al.,1997; Garcıa et al., 1997; Arias-Montano et al., 2001).The results presented herein provide direct support fora previous report (Doreulee et al., 2001) indicating thatH3 receptor activation also inhibits glutamate releasefrom corticostriatal nerve terminals. In addition, ourresults show that H3 receptor activation reduces Ca2+

entry into isolated striatal nerve terminals.The striatum belongs to the basal ganglia, a major

neuronal system which receives cortical inputs, pro-cesses these inputs and feeds them back to the cortexvia connections through the midbrain and thalamus(Alexander and Crutcher, 1990; Gerfen and Wilson,1996). The striatum is the major nucleus of the basalganglia in that it is the target of inputs from most areasof the cortex and provides output to the other compo-nents of the system. Cortical input to the striatum isexcitatory, with glutamate being the main neuro-transmitter used by corticostriatal neurones (Kitai et al.,1976; Spencer, 1976).

In rat striatum perikarya degeneration induced by thelocal administration of kainic and quinolinic acidsdiminishes markedly the number of H3 receptors as esti-mated by radioligand binding (Cumming et al., 1991;Pollard et al., 1993; Ryu et al., 1994). These results indi-cate that a significant fraction of striatal H3 receptors islocated on the GABAergic neurones that project to thesubstantia nigra pars reticulata and the globus pallidus.However, previous results of our own showed the pres-ence of [3H]-N-methyl-histamine binding sites in striatalsynaptosomes (Molina-Hernandez et al., 2000a). Thedensity of synaptosomal H3 receptors (358±15 fmol/mgprotein) was 6-fold of that reported previously for striatalmembranes using [3H]-(R)α-methylhistamine as radioli-gand (Pollard et al., 1993). Histamine H3 receptors maythus be highly concentrated in striatal nerve terminalsmost of which belong to glutamatergic corticostriatalneurones, and results presented here show that H3 recep-tor activation inhibits depolarisation-induced glutamaterelease, as estimated by a fluorometric method.

In our experiments depolarisation was induced with4-aminopyridine (4-AP), a drug that by blocking K +

channels appears to produce tetrotoxin-sensitive repeti-tive firing in isolated nerve terminals (Tibbs et al., 1989),a mechanism more likely to reproduce that occurring inexocytosis triggered by action potentials. Under our con-ditions, a significant fraction of glutamate releasedepended on the presence of Ca2+ ions in the extracellu-lar medium indicating the participation of exocytosis.The Ca2+-independent component of release could beattributed to the effect of depolarisation on glutamatetransporters, that are electrogenic and may operate in areverse manner in response to depolarisation (Adam-Vizi, 1992; Attwell et al., 1993).

Our data showed the Ca2+-dependent component ofdepolarisation-induced glutamate release to be inhibited

in a concentration-dependent manner by a selective H3

agonist, immepip, and this effect was reversed by theselective H3 antagonist thioperamide, with a Ki estimate,4 nM, in good accord with the pA2 value of 5 nMreported for the reversal of (R)-α-histamine-inducedinhibition of neurogenic contractions of guinea-pigjejunum (Leurs et al., 1995). It is worth noting that theH3 antagonist thioperamide has been shown to behave asa potent inverse agonist both at cloned rat H3 receptorsexpressed in high levels in CHO cells and at native H3

receptors controlling histamine release from mousecortical synaptosomes (Morisset et al., 2000). However,in our experiments thioperamide on its own did notincrease either glutamate release or the rise in [Ca2+]i

induced by depolarisation, providing no indication ofconstitutive activity of H3 receptors in our system.

Our observations on the participation of histamine H3

receptors in the control of glutamate release and are ingood agreement with previous reports indicating that his-tamine inhibits glutamatergic transmission in rat hippo-campus (Brown and Reymann, 1996; Brown and Hass,1999) and striatum (Doreulee et al., 2001). In rat stria-tum, both histamine and the H3 agonist R-α-methylhista-mine depress the amplitude of extracellular field poten-tials originating from striatal neurones followingstimulation at the border of the cortex and the striatum.Field potentials were abolished by an antagonist ofAMPA receptors indicating they were due to glutamateacting at ionotropic receptors. On the other hand, hista-mine did not significantly modify the membrane proper-ties of striatal neurones but reduced the amplitude ofexcitatory postsynaptic potentials (EPSPs) and increasedpaired-pulse facilitation (Doreulee et al., 2001). Takentogether, these observations indicate a presynaptic locusof action of histamine, most likely the inhibition of glut-amate release, and our data provide direct support forsuch a proposition.

The existence of three isoforms of the H3 receptordesignated H3A, H3B and H3C has been recently reported(Drutel et al., 2001), with differential expression in thecentral nervous system of the rat. The H3C isoform isstrongly expressed by cortical laminae V and VIb, andfor most cortical areas neurones in layer V are the sourceof the glutamatergic innervation to the striatum (Gerfenand Wilson, 1996), thus raising the possibility that H3C

receptors be responsible for the regulation of glutamaterelease observed in rat striatum.

Regarding the mechanism by which histamine inhibitsglutamate release, the evidence from the inhibitoryaction of H3 receptor activation on depolarisation-induced changes in [Ca2+]i suggests that H3 receptorsreduce Ca2+ entry through voltage-operated Ca2+ chan-nels involved in neurotransmitter release. H3 receptorsappear to be able to couple to both Gαo and Gαi proteins,since there is evidence that H3 receptors produce inhi-bition of N-type voltage-sensitive Ca2+ channels (Endou


et al., 1994; Hill et al., 1997) and a cloned human H3

receptor transfected into mouse L cells has been shownto inhibit forskolin-stimulated cAMP accumulation(Lovenberg et al., 1999).

The maximal inhibition of glutamate release attainableby H3 receptor activation was 60±10% (this study),whereas histamine-induced depression of postsynapticpotentials in rat striatum yielded a maximum of �35%(Doreulee et al., 2001). In rat hippocampus glutamaterelease was sensitive to blockers of both N- and P-typeCa2+ channels (Brown and Hass, 1999) and in rat striatalsynaptosomes 4-AP-induced glutamate release appearsto originate from neurotransmitter pools controlled byboth P/Q- and N-type Ca2+ channels (Hill and Brotchie,1999). The action of H3 receptors could thus be exertedon the component of release due to N-type Ca2+ channels(see above), explaining therefore the portion of releaseunaffected by H3 receptor activation. However, it is clearthat further research is required to establish which typeor types of voltage operated Ca2+ channels are controlledby histamine through H3 receptors.

The functional significance of H3 receptor-mediatedmodulation of glutamate release remains to be estab-lished. Since corticostriatal afferents play a key role ininitiating the activity of basal ganglia pathways(Alexander and Crutcher, 1990; Chevalier and Deniau,1990), the supposition would be that H3 receptors maybe involved in the control of locomotion and there issome evidence in the literature to support this prop-osition. For example, the H3 antagonist thioperamideattenuates amphetamine- or apomorphine-induced loco-motor activity in mice, an effect reversed by the H3

agonist α-methyl-histamine (Clapham and Kilpatrick,1994). Thioperamide also inhibited histamine-inducedhypoactivity whereas the administration of α-methyl-histamine had the opposite effect (Chiavegatto et al.,1998). However, to relate these observations at specificsynapses in the basal ganglia, and in particular in thestriatum, is difficult since the regulation of motor activityby the striatum involves a complex interaction of severalneurotransmitters, and in addition to the reduction ofglutamate release (this report), H3 receptor activationalso inhibits the release of dopamine (Schlicker et al.,1993) and GABA (Arias-Montano et al., 2001) from stri-atal slices.

In summary, our results indicate that H3 receptor acti-vation inhibits glutamate release in rat striatum, presum-ably by inhibiting the entry of Ca2+ through voltage-operated channels. These results, in good agreement witha previous electrophysiological study (Doreulee et al.,2001), indicate that H3 receptor-mediated modulation ofstriatal glutamatergic transmission may provide a sig-nificant mechanism for histamine to regulate basal gang-lia synaptic function.

Acknowledgements

Supported by CINVESTAV and CONACYT (grant28276N). A.M.H. is the recipient of a CONACYT pre-doctoral scholarship. We are thankful to Dr JohnMichael Young (University of Cambridge) for improv-ing the manuscript.

References

Adam-Vizi, V., 1992. External Ca2+-independent release of neuro-transmitters. Journal of Neurochemistry 58, 395–405.

Alexander, G.E., Crutcher, M.D., 1990. Functional architecture ofbasal ganglia circuits: neural substrates of parallel processing.Trends in Neurosciences 13, 266–271.

Arias-Montano, J.A., Floran, B., Garcıa, M., Aceves, J., Young, J.M.,2001. Histamine inhibits depolarisation-induced dopamine-depen-dent release of GABA in rat striatum via an action on H3-receptors.British Journal of Pharmacology 133, 165–171.

Attwell, D., Barbour, B., Szatkowski, M., 1993. Nonvesicular releaseof neurotransmitter. Neuron 11, 401–407.

Brown, R.E., Reymann, K.G., 1996. Histamine H3 receptor-mediateddepression of synaptic transmisssion in the dentate gyrus of the ratin vitro. Journal of Physiology (London) 496, 175–185.

Brown, R.E., Hass, H.L., 1999. On the mechanism of histaminergicinhibition of glutamate release in the rat dentate gyrus. Journal ofPhysiology (London) 515, 777–786.

Clapham, J., Kilpatrick, G.J., 1994. Thioperamide, the selective hista-mine H3 receptor antagonist, attenuates stimulant-induced loco-motor activity in the mouse. European Journal of Pharmacology259, 107–114.

Cheng, Y.-C., Prusoff, W.H., 1973. Relationship between the inhi-bition constant (KI) and the concentration of inhibitor which causes50 per cent inhibition (I50) of an enzymatic reaction. BiochemicalPharmacology 22, 3099–3108.

Craig, D.A., 1993. The Cheng–Prusoff relationship: something lost inthe translation. Trends in Pharmacological Sciences 14, 89–91.

Chevalier, G., Deniau, J.M., 1990. Disinhibition as basic process inthe expression of striatal functions. Trends in Neurosciences 13,277–280.

Chiavegatto, S., Nasello, A.G., Bernardi, M.M., 1998. Histamine andspontaneous motor activity: biphasic changes, receptors involvedand participation of the striatal dopamine system. Life Sciences 62,1875–1888.

Cumming, P., Shaw, C., Vincent, S.R., 1991. High affinity histaminebinding site is the H3 receptor: characterization and autoradio-graphic localization in rat brain. Synapse 8, 144–151.

Doreulee, N., Yanovsky, Y., Flagmeyer, I., Stevens, D.R., Haas, H.L.,Brown, R.E., 2001. Histamine H3 receptors depress synaptic trans-mission in the corticostriatal pathway. Neuropharmacology 40,106–113.

Drutel, G., Peitsaro, N., Karlstedt, K., Wieland, K., Smit, M.J., Timm-erman, H. et al., 2001. Identification of rat H3 receptor isoformswith different brain expression and signaling properties. MolecularPharmacology 59, 1–8.

Endou, M., Poli, E., Levi, R., 1994. Histamine H3-receptor signalingin the heart: possible involvement of Gi/Go proteins and N-typeCa++ channels. Journal of Pharmacology and Experimental Thera-peutics 269, 221–229.

Garcıa, M., Floran, B., Arias-Montano, J.-A., Young, J.M., Aceves, J.,1997. Histamine H3 receptor activation selectively inhibits dopam-ine D1 receptor-dependent [3H]-γ-aminobutyric acid release fromdepolarisation-stimulated slices of rat substantia nigra pars reticul-ata. Neuroscience 80, 241–249.


Gerfen, C.R., Wilson, C.J., 1996. The basal ganglia. In: Bjorklund, A.,Hokfelt, T. (Eds.), Handbook of Chemical Neuroanatomy, vol. 12.Elsevier, Amsterdam, pp. 369–466.

Gray, E.G., Whittaker, V.P., 1962. The isolation of nerve endings frombrain: an electron microscopic study of cell fragments derived byhomogenization and centrifugation. Journal of Anatomy (London)96, 79–84.

Grynkiewicz, G., Poenie, M., Tsien, R.Y., 1985. A new generationof Ca2+ indicators with greatly improved fluorescence properties.Journal of Biological Chemistry 260, 3440–3450.

Hill, S.J., Ganellin, C.R., Timmerman, H., Schwartz, J.C., Shankley,N.P., Young, J.M. et al., 1997. Classification of histamine recep-tors. Pharmacological Reviews 49, 253–278.

Hill, M.P., Brotchie, J.M., 1999. Control of glutamate release by cal-cium channels and �-opioid receptors in rodent and primate stria-tum. British Journal of Pharmacology 127, 275–283.

Kitai, S.T., Koscis, J.D., Preston, R.J., Sugimori, M., 1976. Monosyn-aptic inputs to caudate neurons identified by intracellular injectionof horseradish peroxidase. Brain Research 109, 601–606.

Leurs, R., Smit, M.J., Timmerman, H., 1995. Molecular pharmacologi-cal aspects of histamine receptors. Pharmacy and Therapeutics 66,413–463.

Liu, C., Ma, X.-J., Jiang, X., Wilson, S.J., Hofstra, C.L., Blevitt, J. etal., 2001. Cloning and pharmacological characterization of a fourthhistamine receptor (H4) expressed in bone marrow. Molecular Phar-macology 59, 421–426.

Lovenberg, T.W., Roland, B.L., Wilson, S.J., Jiang, X., Pyati, J.,Huvar, A. et al., 1999. Cloning and functional expression of thehuman histamine H3 receptor. Molecular Pharmacology 55,1101–1107.

Lowry, D.H., Rosenbrough, N.J., Farr, A.L., Randall, R.J., 1951. Pro-tein measurement with the Folin phenol reagent. Journal of Biologi-cal Chemistry 193, 265–275.

Martınez-Mir, M.I., Pollard, H., Moreau, J., Arrang, J.M., Ruat, M. etal., 1990. Three histamine receptors (H1, H2 and H3) visualizedin the brain of human and non-human primates. Brain Research526, 322–327.

Molina-Hernandez, A., Nunez, A., Arias-Montano, J.-A., 2000a. Hista-mine H3-receptor activation inhibits dopamine synthesis in rat stria-tum. NeuroReport 17, 163–166.

Molina-Hernandez, A., Nunez, A., Arias-Montano, J.-A., 2000b. Hista-mine H3-receptor activation inhibits glutamate release from rat stri-atal synaptosomes. Society for Neuroscience Abstracts 26 (1438),538.4.

Morisset, S., Rouleau, A., Ligneau, X., Gbahou, F., Tardivel-Lacombe,

J., Stark, H. et al., 2000. High constitutive activity of native H3

receptors regulate histamine neurons in brain. Nature 14, 860–864.Nicholls, D.G., Sihra, T.S., Sanchez-Prieto, J., 1987. Calcium-depen-

dent and independent release of glutamate from synaptosomesmonitored by continuous fluorometry. Journal of Neurochemistry49, 50–57.

Nguyen, T., Shapiro, D.A., George, S.R., Setola, V., Lee, D.K., Cheng,R. et al., 2001. Discovery of a novel member of the histaminereceptor family. Molecular Pharmacology 59, 427–433.

Oda, T., Morikawa, N., Saito, Y., Masuho, Y., Matsumoto, S., 2000.Molecular cloning and characterization of a novel type of histaminereceptor preferentially expressed in leukocytes. Journal of Biologi-cal Chemistry 275, 36781–36786.

Onodera, K., Yamatodani, A., Watanabe, T., Wada, H., 1994. Neuro-pharmacology of the histaminergic neuron system in the brain andits relationship with behavioral disorders. Progress in Neurobiology42, 685–702.

Pollard, H., Moreau, J., Arrang, J.M., Schwartz, J.-C., 1993. A detailedautoradiographic mapping of histamine H3 receptors in rat brainareas. Neuroscience 52, 169–189.

Ryu, J.H., Yanai, K., Iwata, R., Ido, T., Watanabe, T., 1994. Heterog-enous distribution of histamine H3, dopamine D1 and D2 receptorsin rat brain. NeuroReport 5, 621–624.

Schlicker, E., Fink, K., Detzner, M., Gothert, M., 1993. Histamineinhibits dopamine release in the mouse striatum via presynaptic H3

receptors. Journal of Neural Transmission 93, 1–10.Spencer, H.J., 1976. Antagonism of cortical excitation of striatal neu-

rons by glutamic acid diethylester: evidence for glutamic acid asan excitatory neurotransmitter in the rat striatum. Brain Research102, 91–101.

Schwartz, J.C., Arrang, J.-M., Garbarg, M., Pollard, H., Ruat, M.,1991. Histaminergic transmission in the mammalian brain. Physio-logical Reviews 71, 1–51.

Tibbs, G.R., Barrie, A.P., Van Mieghem, F.J.E., McMahon, H.T.,Nicholls, D.G., 1989. Repetitive action potentials in isolated nerveterminals in the presence of 4-aminopyridine: effects on cytosolicfree Ca2+ and glutamate release. Journal of Neurochemistry 53,1639–1699.

Wada, H., Inagaki, N., Yamatodani, A., Watanabe, T., 1991. Is thehistaminergic neuron system a regulatory center for whole-brainactivity? Trends in Neurosciences 14, 415–418.

Zhu, Y., Michalovic, D., Wu, H.-L., Tan, K.B., Dytko, G.M., Mannan,I.J. et al., 2001. Cloning, expression, and pharmacological charac-terization of a novel human histamine receptor. Molecular Pharma-cology 59, 434–441.

Departamento de Neurociencias, Instituto de Fisiologıa Celular, Universidad Nacional Autonoma de Mexico, Mexico D.F., Mexico

Histamine (HA) is produced, stored, released and metabo-lized in the brain, filling the criteria for a neurotransmitter/neuromodulator (Schwartz et al. 1991; Hill et al. 1997). Inthe adult CNS, HA regulates pre- and post-synaptically avariety of functions, such as wakefulness, feeding, drinking,body temperature and motor activity (Schwartz et al. 1979;Knigge and Warberg 1991; Wada et al. 1991; Onodera et al.1994; Haas and Panula 2003). These HA actions aremediated by the activation of three different histaminergicG protein-coupled receptors named H1R, H2R and H3R,which are widely distributed throughout the CNS (Hill et al.1997), and have been cloned and characterized by theirpharmacology and signal transduction mechanisms (Gantzet al. 1991; Yamashita et al. 1991; Lovenberg et al. 1999;Tardivel-Lacombe et al. 2000). Activation of H1R and H2Rexcites neurons or potentiates excitatory inputs (Haas andPanula 2003), while activation of H3R causes inhibition ofsynthesis and release of HA and other neurotransmitters(Clapham and Kilpatrick 1992; Schlicker et al. 1994;Molina-Hernandez et al. 2000, 2001). The affinity of HAfor these receptors vary: H1R and H2R are activated at

lmolar concentrations of HA (Garbarg and Schwartz 1987;Traiffort et al. 1994), whereas H3R respond to HA in the nMrange (Rouleau et al. 2004).

During rat development, HA is one of the first neuro-transmitters to be present in CNS, starting at embryonic day(E) 12, and reaching its maximum value at E14–E16, decreas-ing afterwards 5-fold to adult levels in the prosencephalicarea (Vanhala et al. 1994). Between E14 and E18, fibersfrom transient histaminergic neurons in the mesencephalon

Received December 17, 2007; revised manuscript received March 26,2008; accepted April 8, 2008.Address correspondence and reprint requests to Ivan Velasco,

Departamento de Neurociencias, Instituto de Fisiologıa Celular, Uni-versidad Nacional Autonoma de Mexico, Mexico D.F.-04510, Mexico.E-mail: [email protected] used: bFGF, basic fibroblast growth factor; BrdU,

bromodeoxyuridine; D, differentiated; E, embryonic day; GFAP, glialfibrillar acidic protein; HA, histamine; MAP2, microtubule associatedprotein 2; ND, non-differentiated; NGS, normal goat serum; NSC, neuralstem cells; P, passage; PBS, phosphate buffered saline; TUNEL, terminaldeoxyuridine triphosphate nick end labelling.

Abstract

Histamine has neurotransmitter/neuromodulator functions in

the adult brain, but its role during CNS development has been

elusive. We studied histamine effects on proliferation, cell

death and differentiation of neuroepithelial stem cells from rat

cerebral cortex in vitro. RT-PCR and Western blot experi-

ments showed that proliferating and differentiated cells ex-

press histamine H1, H2 and H3 receptors. Treatments with

histamine concentrations (100 nM–1 mM) caused significant

increases in cell numbers without affecting Nestin expression.

Cell proliferation was evaluated by BrdU incorporation; hista-

mine caused a significant increase dependent on H2 receptor

activation. Apoptotic cell death during proliferation was sig-

nificantly decreased at all histamine concentrations, and cell

death was promoted in a concentration-dependent manner by

histamine in differentiated cells. Immunocytochemistry studies

showed that histamine increased 3-fold the number of neu-

rons after differentiation, mainly by activation of H1 receptor,

and also significantly decreased the glial (astrocytic) cell

proportion, when compared to control conditions. In summary,

histamine increases cell number during proliferative condi-

tions, and has a neuronal-differentiating action on neural stem

cells, suggesting that the elevated histamine concentration

reported during development might play a role in cerebro-

cortical neurogenesis, by activation of H2 receptors to pro-

mote proliferation of neural precursors, and favoring neuronal

fate by H1-mediated stimulation.

Keywords: apoptosis, brain development, cerebral cortex,

histamine receptors antagonists, neural precursors, neuro-

genesis.

J. Neurochem. (2008) 106, 706–717.

JOURNAL OF NEUROCHEMISTRY | 2008 | 106 | 706–717 doi: 10.1111/j.1471-4159.2008.05424.x

706 Journal Compilation � 2008 International Society for Neurochemistry, J. Neurochem. (2008) 106, 706–717� 2008 The Authors

can be detected, passing through the ventral tegmental areaand within the medial forebrain bundle and the optic tract,reaching the frontal and the parietal cortex at E15, earlierthan other monoaminergic systems (Specht et al. 1981;Lidov and Molliver 1982; Auvinen and Panula 1988; Reineret al. 1988; Vanhala et al. 1994), which coincides with theperiod where neuronal differentiation is occurring in cerebralcortex (Sauvageot and Stiles 2002). Messenger RNA of H1Rand H2R are widely distributed in the developing CNS,whereas H3R is present in spinal cord and mesencephalon,appearing in cerebral cortex at E19 (Kinnunen et al. 1998;Heron et al. 2001; Karlstedt et al. 2001a, 2003). Thedevelopmental role of HA in the nervous system, includingthe cerebral cortex is still unknown (Mezei and Mezei 1978;Happola et al. 1991; Vanhala et al. 1994; Nissinen andPanula 1995; Nissinen et al. 1995).

A correlation of neurogenesis and elevations of HA incerebral cortex can be proposed from the above mentionedfindings. However, a direct approach to test this link has notbeen reported. Neural stem cells (NSC) are key players inbrain development (Temple 2001). This study was designed toestablish the role of HA on NSC by exploring in vitro theeffect of this biogenic amine on cell proliferation, apoptosis,and differentiation using rat cortical precursor cells from E14.We show that HA is a positive modulator in proliferation/expansion of NSC, and also a factor that promotes neuronaldifferentiation of neural precursors; in this study we identifiedthe histaminergic receptors responsible for these effects.

Materials and methods

Cell cultureIn order to obtain multipotent NSC (Johe et al. 1996), E14 embryos

were extracted from pregnant Wistar rats and cerebral cortices were

dissected in Krebs solution (100 mM NaCl, 2 mM KCl, 0.6 mM

KH2PO4, 12 mM NaHCO3, 7 mM glucose, 0.1% phenol red, 0.3%

bovine serum albumin and 0.3% magnesium sulfate). The tissue was

mechanically dissociated to a single cell suspension. Cells were

recovered by centrifugation, resuspended and cultured on plastic-

ware previously treated with 15 lg/mL poly-L-ornithine (Sigma)

and 1 lg/mL human fibronectin (Invitrogen) in fully defined N2

medium containing 10 ng/mL basic fibroblast growth factor (bFGF;

R & D Systems and Peprotech) as mitogen. Passage (P) of cells was

made with 0.1 mM EDTA in phosphate buffered saline (PBS). P2

cells were maintained during 4 days in proliferative control (N2

medium + 10 ng/mL bFGF) and experimental (N2 medium +

10 ng/mL bFGF + different concentrations of HA from 100 nM

to 1 mM) conditions. For immunocytochemistry and terminal

deoxyuridine triphosphate nick end labelling (TUNEL) assays, cells

were seeded at 1 · 104/well onto 12 mm coverslips in 24-well

plates (Corning) in control and experimental conditions. For crystal

violet assays, cells were seeded at the same density without

coverslips. Differentiation was promoted by removing bFGF and

keeping the cells for 6 days in N2 medium + 200 lM ascorbic acid

in the presence or absence of HA. In the case of HA-treated cells,

addition of HA was made during proliferation and differentiation

phases.

Histamine H1, H2 and H3 receptor antagonists were used to study

the effect of 100 lM HA on cell proliferation and differentiation.

Chlorpheniramine (Sigma) was used as a H1R antagonist at 1 lM;

as a H2R antagonist, we used 30 lM cimetidine (Sigma). Thio-

peramide (Sigma) at 1 lM was used to block H3R. H1R, H2R or

H3R antagonists were added to control and 100 lMHA-treated cells

during proliferation. Differentiation was promoted by removing

bFGF and keeping the cells for 6 days in N2 medium + 200 lMascorbic acid in the presence or absence of 100 lM HA, with or

without the antagonists.

RNA extraction and RT-PCRTotal RNA was isolated from non-differentiated (ND) and

differentiated (D) cultures, using TRIZOL (Invitrogen). For RNA

extraction, cells were seeded at 3 · 105 in 6-well plates (Corning).

Total RNA (1.0 lg) was reverse transcribed with random hexamers

and 2 lL from the RT reaction were used in PCR containing 2 U

Taq DNA polymerase (Invitrogen), 20 pmol of specific primers

(Sigma), 500 lM deoxynucleoside triphosphates and 1.5 mM

MgCl2 (for H1R and H3R) or 2 mM MgCl2 (for H2R). For

amplification of cDNA encoding histaminergic receptors, the

following reported forward (F) and reverse (R) primer sequences

were used: H1R, F:5¢-CTTCTACCTCCCCACTTTgCT-3¢, R:5¢-TTCCCTTTCCCCCTCTTg-3¢; H2R, F:5¢-TTCTTggACTCCTggT-gCTgC-3¢, R:5¢-CATgCCCCCTCTggTCCC-3¢ and for H3R, F:5¢-CCAgAACCCCCACCAgATg-3¢, R:5¢-CCAgCAgAgCCCAAA-gATg-3¢. The conditions used were as follows for H1R and H3R:

denaturalization at 95�C for 15 min, 30 cycles of denaturalization

at 95�C for 1 min, annealing at 58�C for 1 min, and elongation at

72�C for 1 min. For H2R: denaturalization at 95�C for 15 min, 30

cycles of denaturalization at 95�C for 1 min, annealing at 62�C for

1 min, and elongation at 72�C for 1 min. Final extension at 74�Cfor 10 min was terminated by rapid cooling at 4�C. PCR products

were analyzed in 2% agarose gel electrophoresis and the size of

the reaction products was determined by comparison with

molecular weight standards after ethidium bromide staining. As a

negative control for PCR amplification, reactions with RNA in the

absence of retrotranscription were included. The positive control

consisted of RNA extracted from adult rat cerebral cortex, which

was used to synthesize cDNA and amplified by PCR as described

above.

Representative bands of the amplified PCR products were

recovered from gels using the Qiaquick gel extraction kit (Qiagen)

according to manufacturer’s instructions. We sequenced these bands

at the Molecular Biology Unit in our institute, and confirmed that all

bands correspond indeed to histaminergic receptors, in accordance

with previous data (Azuma et al. 2003). GenBank accession

numbers used to confirm the sequence from mRNA and the

expected PCR product sizes are as follows: H1R (292 bp amplifi-

cation product, primers encompassing nucleotides 593–885),

AF387880; H2R (309 bp amplification product, primers encom-

passing nucleotides 196–505), NM012965; H3RA (393 bp amplifi-

cation product, primers encompassing nucleotides 720–1113),

AY009370; H3RB (297 bp amplification product, primers encom-

passing nucleotides 720–1017), AY009371; H3RC (249 bp ampli-

fication product, primers encompassing nucleotides 1055–1304),

� 2008 The AuthorsJournal Compilation � 2008 International Society for Neurochemistry, J. Neurochem. (2008) 106, 706–717

Histamine actions on cortical stem cells | 707

BC087707 (Azuma et al. 2003; Bakker 2004). H3RA and H3RB are

also know as H3RL and H3RS, respectively.

Electrophoresis and western blotAssays were performed as described (Diaz et al. 2007). Briefly,cells from proliferative and differentiated cultures, or from adult

cerebral cortex were homogenized in lysis buffer supplemented

with protease inhibitors (Roche, Germany). Proteins were obtained

by centrifugation at 13 800 g at 4�C for 15 min, and quantified by a

modified Bradford assay (BioRad, Germany). Proteins (40 lg) wereresolved on 8% sodium dodecyl sulfate–polyacrylamide gel

electrophoresis and transferred to nitrocellulose membranes (Amer-

sham Bioscience, USA) which were blocked with 5% non-fat dry

milk and incubated overnight with primary antibodies. Pre-stained

markers (Invitrogen) were included for size determination. The

following antibodies were used: rabitt anti-rat H1R polyoclonal

antibody (diluted 1 : 1500, Santa Cruz Biotechnology, USA); goat

anti-rat H2R polyclonal antibody (diluted 1 : 1500, Santa Cruz

Biotechnology) and rabbit anti-rat H3R polyclonal antibody

(1 : 1000, Alpha Diagnostics). Membranes were washed and

incubated with corresponding horseradish peroxidase-coupled sec-

ondary antibodies (Santa Cruz Biotechnology; diluted 1 : 15 000).

Immunoreactive bands were detected using enhanced chemilumi-

nescence method (Amersham) and film exposure. When needed,

membranes were stripped for reproving using a commercial

solution (Chemicon).

Crystal violet assayThe number of cells was measured by the crystal violet assay, in

which optic density is correlated with the amount of viable cells

(Bonnekoh et al. 1989). Cells were fixed in 10% formol-PBS, pH

7.4, washed and incubated with a 0.5% solution of crystal violet for

10 min at 21�C. After thorough washing with bi-distillated water,

acetic acid (33% vol:vol in H20) was added to elute the dye. The

absorbance was determined at 595 nm in a spectrophotometer

(Beckman DU650), and measurements were expressed as percent

increases in the absorbance with respect to control conditions.

Bromodeoxyuridine (BrdU) incorporation assayFor cell proliferation analysis, cells treated with bFGFwere incubated

during 3 h with 10 lM 5-bromo-2-deoxyuridine (BrdU, Roche),

washed with fresh medium with bFGF and fixed 21 h later. After

fixation with 4% paraformaldehyde in PBS, pH = 7.4 for 20 min at

4�C, cells were incubated with 1 N HCl for 30 min at 25�C, andneutralized by washing three times in 0.1 M borate buffer, pH 8.5.

Preparationswere blocked for 1 hwith 0.3% tritonX-100 (Sigma) and

10% normal goat serum (NGS,Microlab, Mexico) in PBS. Cells were

incubated overnight at 4�C with monoclonal rat anti-BrdU antibody

(Accurate) at 1 : 100 dilution in blocking solution without triton.

Three washes with 1% bovine serum albumin/PBS were made and

then secondary antibody was added (Alexa Fluor 488 goat anti-rat

IgG; Molecular Probes) at 1 : 1000 dilution in blocking solution

without triton for 1 h at 25�C in the dark, and washed three times with

PBS. Nuclei were stained with Hoechst 33258 (1 ng/mL; Sigma).

Immunostaining were observed with an epifluorescence microscope

(Nikon, Eclipse TE2000-U) and photographed with a Nikon digital

camera (DMX1200 F). Negative controls were performed in the

absence of primary antibodies and showed no unspecific staining.

ImmunocytochemistryStandard procedures reported before were used (Velasco et al. 2003;Diaz et al. 2007). Cortical cells were fixed at day 4 of proliferation

or at day 6 of differentiation with 4% paraformaldehyde in PBS, pH

7.4 for 20 min at 4�C, permeabilized and blocked for 1 h with 0.3%

triton X-100 and 10% NGS in PBS. Cells were incubated overnight

at 4�C with the following primary antibodies, diluted in PBS

containing 10% NGS: rabbit polyclonal anti-b tubulin III (1 : 2000,

Babco Covance); rabbit polyclonal anti-glial fibrillary acidic protein

(GFAP; 1 : 2000, DAKO); mouse monoclonal antibody anti-

microtubule associated protein 2 (MAP2; 1 : 500, Chemicon);

mouse monoclonal anti-Nestin (1 : 100; Developmental Studies

Hybridoma Bank). Alexa-Fluo 488 anti-rabbit IgG, Alexa 568 anti-

mouse IgG were used as secondary antibodies (1 : 500; Molecular

Probes) diluted in PBS/10% NGS. Nuclei were counterstained with

Hoechst 33258 (1 ng/mL; Sigma). Immunostainings were visualized

and photographed as described above. Negative controls made as

described previously did not show unspecific staining.

TUNEL assayNeural stem cells in P2 were plated onto 12 mm coverslips and daily

treated with HA, or maintained in control conditions. Cells were fixed

with 4% paraformaldehyde, after 4 days of proliferation or 6 days of

differentiation, and subsequently washed three times with PBS

pH = 7.4. For detection of apoptotic cells, the Terminal deoxy-

transferase-mediated deoxyuridine triphosphate nick-end labeling (In

Situ Cell Death Detection Kit, Roche Diagnostics) was used to

evaluate the effect of HA on cell death. Apoptotic cells were

visualized by fluorescence microscopy. To analyze the response of

differentiated cells to the used HA concentrations, we used GraphPad

software to adjust the data to a sigmoidal curve to calculate the

maximum effect and the effective concentration to have 50% of

maximal response (EC50).

Cell countingCell counts from BrdU, immunocytochemistry and TUNEL exper-

iments were performed from pictures taken with a Nikon digital

camera and the Nikon ACT-1 imaging software. Quantification of

cells was performed by counting the number of Hoechst stained

nuclei (total cells) and the specified markers in at least eight random

fields in duplicate, from 3–6 independent experiments.

StatisticsAll data are presented as mean ± standard error of mean (S.E.M).

One-way ANOVA was performed for statistical analysis, and multiple

comparisons between treated and control groups were made using

the post-hoc Student-Newman-Keuls test. Differences were consid-

ered statistically significant at p < 0.05. Graphs and fit adjustment

were performed using GraphPad Instat software.

Results

We first studied if cortical NSC express HA receptors byRT-PCR in ND and D cultures without HA treatment. Weobserved that NSC, at the end of both proliferation anddifferentiation stages contain mRNA for H1R, H2R andH3R receptors (Fig. 1a). The PCR amplification products

Journal Compilation � 2008 International Society for Neurochemistry, J. Neurochem. (2008) 106, 706–717� 2008 The Authors

708 | A. Molina-Hernandez and I. Velasco

were gel-extracted and sequenced. With the resultingsequence for each band, we confirmed that mRNA forhistaminergic receptors were present in NSC. H3R waspresent in three bands that correspond to H3RA, H3RB andH3RC. Western blot analysis of cell extracts at the sametime points showed that ND and D cells express H1R, H2R

and H3R. For H1R and H2R, a single band was observed,which match the reported molecular weights of thesereceptors (Smit et al. 1995; Matsuda et al. 2004). In thecase of H3R, we identify several bands (Fig. 1b), whichhave molecular weights similar to those observed by others(Karlstedt et al. 2003).

Effects of histamine on proliferative cells

Effect of HA on Nestin expression in proliferatingneural stem cellsNestin is a component of intermediate filaments used toidentify NSC (Johe et al. 1996). To study whether HA wasable to modify the phenotype of NSC in terms of Nestinexpression, cells were daily treated with different concentra-tions of HA (100 nM, 1 lM, 10 lM, 100 lM and 1 mM),added in the presence of bFGF. Table 1 shows that HA didnot affect the proportion of NSC in culture, since in all HAconcentrations used, the values were above 96% of Nestin-positive cells. At the same time, we explored the possibilitythat HA could promote early differentiation by identifyingimmunocytochemically the expression of b-tubulin III (anearly marker of neurons) or GFAP (astrocyte marker) underproliferative conditions. Our results show only few double-positive cells for Nestin/b-tubulin III and Nestin/GFAP(proportions < 0.75% in all cases).

Effect of HA on cell number during proliferationTo study HA effect on NSC number, cells were daily treatedwith increasing concentrations of HA in the presence of10 ng/mL bFGF during 4 days and NSC number wasevaluated with crystal violet assay. HA produced significantincreases up to 139% of control at all tested concentrations(Fig. 2a). We also quantified the number of cells present atthis stage by counting the Hoechst-stained nuclei in eightrandom fields. We found significant raises (49–76%) at allHA concentrations used, except 100 nM (21% increase,Fig. 2b).

Table 1 Effect of histamine on Nestin expression by proliferating cortical neural stem cells

Control

Histamine

100 nM 1 lM 10 lM 100 lM 1 mM

% Nestin 97.4 ± 1.2 96.4 ± 2.6 98.2 ± 0.7 98.0 ± 0.5 97.0 ± 1.8 96.7 ± 0.2

%Nestin+

GFAP+

0.05 ± 0.05 0.54 ± 0.53 0.04 ± 0.04 0.75 ± 0.63 0.18 ± 0.06 0.0 ± 0.0

%Nestin+

b-tubulin III+

0.22 ± 0.15 0.13 ± 0.07 0.15 ± 0.08 0.28 ± 0.28 0.22 ± 0.16 0.23 ± 0.05

Cells were kept in proliferative conditions (N2 medium + 10 ng/mL bFGF) and treated daily with increasing concentrations of HA during 4 days.

Results are expressed as percentages of labeled cells referred to the total cell number detected by Hoechst staining of nuclei. Double immu-

nocytochemistry was made with two combinations of primary antibodies: Nestin/GFAP or Nestin/b-tubulin III. Fluorescent secondary antibodies

were added to quantify positive cells. Microphotographs were taken at 40X from eight fields in three independent experiments. Results are

expressed as the mean ± SEM. No statistically significant differences were found.

(a)

(b)

Fig. 1 Neural stem cells from cerebral cortex at P2 express histamine

receptors. (a) RT-PCR analysis of H1-, H2- and H3-receptor mRNAs in

non-differentiated (ND) and differentiated (D) cells. One lg of total

RNA from adult rat cerebral cortex (Ctx), ND or D cortical neural stem

cells were subjected to reverse transcription. The obtained cDNAs

were amplified for 30 cycles using receptor-specific primers. The

expression of gene transcripts for H1-, H2- and H3-receptors was

analyzed by electrophoresis on a 2% agarose gel. Rat adult cortex

was used as positive control, and RNA without retrotranscription (-RT)

yielded no signal. Representative image of five independent experi-

ments. (b) A representative assay of three western blot experiments,

performed to detect H1, H2 and H3 receptors in Ctx, ND and D cells.

Forty lg of total were resolved on 8% SDS-PAGE and transferred to

nitrocellulose membranes, and probed with anti-HA receptors anti-

bodies. Immunoreactive bands were detected by enhanced chemi-

luminescence.



To more directly asses HA effects on proliferation, weperformed BrdU incorporation experiments with or without100 lM HA (Fig. 2c). In control conditions, roughly 40% ofND NSC incorporated BrdU. Treatment with 100 lM HAsignificantly increased to 77% BrdU-positive cells (Fig. 2d).To evaluate if HA receptors were responsible for thisincrease, we decided to test H1R, H2R and H3R antagonists.Cells with or without 100 lM HA were daily-treated with1 lM chlorpheniramine (H1R antagonist), 30 lM cimetidine(H2R blocker) or 1 lM thioperamide (H3R antagonist). Ourresults show that the increase on NSC proliferation inducedby HA is due mostly to activation of H2R, since blocking ofthis receptor completely and significantly reversed the effectof 100 lM HA, obtaining similar values to those seen under

control conditions (Fig. 2c and d). Although the H1Rantagonist also significantly decreased HA effect on cellproliferation to 63%, the effect of HA remained, sinceblocking of this receptor resulted in a significantly highervalue than control. H3R antagonism did not modify HAeffect (Fig. 2d). Treatment with HA receptors antagonists inthe absence of HA did not modify control values.

Effect of HA on TUNEL-positive cellsIn order to asses whether the increase in proliferation causedby HA was associated with a decrease in programmed celldeath, we compared the number of TUNEL-positive cells incontrols and HA-treated cells, at the end of the proliferativephase. Cell death under control conditions was 2.8 ± 0.3% oftotal cells. At all concentrations, HA produced significantdecreases in TUNEL positive cell numbers (Fig. 3a), withthe maximum effect at 1 lM (59% reduction relative to thecontrol) and the minimum at 100 nM (32% less than control;Fig. 3b). Since activation of H2R was necessary to observeHA-promoting effects on proliferation, we evaluated ifblockade of this receptor could also prevent the decrease incell death observed with 100 lM HA. In this set ofexperiments (n = 3), the proportion of TUNEL-positive cellswere: control: 3.5 ± 0.3%; 30 lM cimetidine: 3.4 ± 0.1%;100 lM HA: 1.7 ± 0.1% (p £ 0.05 relative to control);100 lM HA ± 30 lM cimetidine: 13.0 ± 0.8% (p £ 0.001vs. both control and 100 lM HA).

Effect of HA on differentiated NSCTo promote differentiation of cortical NSC to neuronal andglial lineages, bFGF was excluded from the medium andcells were maintained in N2 medium during 6 days in controlcultures, with daily HA treatments at the indicated values in

(a)

(b)

(c)

(d)

Fig. 2 Histamine increases proliferation of cortical NSC. Cells were

kept in N2 medium with 10 ng/mL bFGF and treated daily with

increasing concentrations of HA during 4 days. HA effect on cell

number was evaluated by crystal violet assay (a) and by cell counting

(b) after Hoechst staining of nuclei. For crystal violet, the resulting

absorbance in each condition was expressed as percent of the control

value (zero HA). Results are means ± SEM from 3–5 experiments.

(*)p < 0.05 vs. control condition. (c) Representative micrographs of the

antagonic effect of cimetidine on HA-induced increase in BrdU incor-

poration. Control cells incorporated BrdU (red) in the absence of HA.

The proportion of BrdU+ cells augmented 2-fold when 100 lM HA was

present in the cultures. This effect was prevented by the H2R antag-

onist cimetidine. (d) Quantification of BrdU incorporation experiments.

HA caused a significant increase in the percentage of positive cells for

BrdU. This effect depends on H2R activation, since cimetidine (Cimet.)

completely reversed it. Neither chlorpheniramine (Chlorph., H1R

antagonist) nor thioperamide (Thioper., H3R blocker) had this effect.

To obtain the total number of cells, we quantified the nuclei stained

with Hoechst from the combined values of eight fields in duplicate.

Results are means ± SEM from 3–6 experiments. (a) p < 0.05 vs.

control condition; (b) p < 0.01 vs. 100 lM HA. Scale bar = 50 lm.



the concentration-response curve, or with daily 100 lM HAin the presence of H1R, H2R or H3R antagonists.

Effect of HA on the number of differentiated cellsThe effect of HA on cell number after NSC differentiationwas next examined. Cell number estimated by the crystalviolet assay showed no differences in any of the experimentalcondition versus control cells (Fig. 4).

Effect of HA on TUNEL positive cellsTo evaluate cell death after 6 days of bFGF withdrawal, weperformed TUNEL detection at the end of differentiation.Control apoptotic cell death was 22.8 ± 1.3% relative to thetotal number of nuclei detected by Hoechst. The treatmentwith increasing concentrations of HA showed a significantdose-dependent increase in the proportion of TUNEL-positive cells at 10 lM, 100 lM and 1 mM HA, with25%, 43% and 60% increases on TUNEL positive cells,respectively, when compared with control conditions. Best-fitadjustment to a sigmoidal dose-response curve yielded amaximum effect of 35.7 ± 1.1% of TUNEL-positive cells

and revealed an EC50 = 13.0 ± 0.2 lM of HA (n = 3;Fig. 5).

Effect of HA on cell phenotypes after NSC differentiationTo investigate whether HA could modify the differentiationof cortical NSC, we quantified the number of neurons andglial cells by performing double immunodetection of MAP2(a mature neuron marker) and GFAP (astrocytic marker) incontrol and HA-treated cultures. HAwas able to significantlyreduce the number of GFAP-positive cells, and also signif-icantly, to increase MAP2-positive cells after treating cellswith concentrations from 1 lM up to 1 mM HA (Fig. 6a andb). The maximum increase in the number of neurons wasseen at 1 mM HA, increasing form 7.9% to 23.4% (2.96times more neurons relative to control). The proportion ofGFAP-positive cells in differentiated cultures decreasedsignificantly after incubation with concentrations of 1 lMHA and higher, reducing by about 50% the number of glialcells found in controls. In control conditions, the ratioastrocytes/neurons was 5 and this decreased in a range of 0.8to 1.3 with HA concentrations above 1 lM (Fig. 6b).

Treatments with H1R, H2R or H3R antagonists showedthat the effect of HA on neuronal differentiation of neuralprogenitors is largely due to H1R activation, since 1 lMchlorpheniramine significantly decreased MAP2-positivecells to values similar to control conditions when cells areco-treated with 100 lM HA (from 29.8% to 13.4%),inducing a significant change on the ratio astrocytes/neuronsfrom 0.7 (100 lM HA) and to a value of 2 (100 lMHA + H1R antagonist). In contrast, 30 lM cimetidine wasnot able to modify either MAP2 positive cells, nor astrocytes/neurons ratio (0.9) from the values observed with 100 lMHA. Thioperamide did not revert the effect of HA, since31.8% of cells were MAP2-positive and the resulting ratiowas 0.7, when 100 lM HA and this H3R antagonist were

(a)

(b)

Fig. 3 Histamine reduces apoptosis in proliferative NSC. Cells ex-

posed to 10 ng/mL bFGF and treated with increasing concentrations

of HA showed a significant decrease on TUNEL-positive cells. (a)

Representative micrographs of the effect of HA on TUNEL-positive

cells (green, arrows), showing the reduction in the proportion of green

cells that are positive, relative to the nuclei stained with Hoechst

(blue). Scale bar = 50 lm. (b) Quantification of the total TUNEL-

positive cells from eight fields in duplicate from three independent

experiments. Results are means ± SEM. (*)p < 0.05 and (**)p < 0.001

vs. control.

Fig. 4 Effect of histamine on cell number after differentiation. Differ-

entiated cells were maintained in N2 medium without bFGF and

treated daily with increasing concentrations of HA. After 6 days, HA

effect on the final number of cells was estimated by crystal violet

assay. Results are means ± SEM from 3–5 experiments. Results are

expressed as the percent change compared with control.



present. Interestingly, although the number of neurons is notmodified by H2R or H3R antagonists, we found significantdecreases relative to control conditions in the number of glialcells when either chlorpheniramine, cimetidine or thio-peramide were incubated with 100 lM HA. None of theHA receptor antagonists, modified the number of neurons orastrocytes from control values in the absence of HA (data notshown).

Discussion

Neural stem cells are important elements of the developingnervous system that can be isolated and grown in vitro tostudy the role of a number of factors that might affectproliferation and cell fate. In these cells, we show here thatHA induce the following effects: (i) expansion of NSC

numbers due to an increase in proliferation caused byactivation of H2R; (ii) decreased apoptosis in NSC stimulatedwith bFGF; (iii) a concentration-dependent induction ofTUNEL-positive cells in the differentiation phase, and (iv)higher number of neurons after differentiation of NSC, aneffect due to H1R activation.

The biogenic amine HA, which acts as a neurotrans-mitter/neuromodulator in the adult rat CNS (Schwartz et al.1991; Hill et al. 1997), is present in high concentrations(five times higher than those found in adult brain) in theprosencephalic area at E14, and these levels remainelevated until E17 (Vanhala et al. 1994) suggesting a roleof HA in neurogenesis occurring in that period. Histamin-ergic receptors must be in place for HA to act. Expressionof histaminergic receptors at these stages of developmenthas been reported. Hybridization studies show the distri-bution of mRNA for HA receptors in different brainregions, but no information about the cell types expressingthe receptors is provided (Kinnunen et al. 1998; Heronet al. 2001; Karlstedt et al. 2001b, 2003). It has beenshown that the cerebral cortical area expresses H1R at E14(Kinnunen et al. 1998). Little is known about H2Rexpression before E15, but after this age it can be clearlydetected in the cerebral cortex (Karlstedt et al. 2001a).Messenger RNA for H3R is detected in E19 in the corticalarea (Karlstedt et al. 2003). There are no reports showingthe expression of HA receptors in NSC. We show in thisstudy that cortical NSC express H1R, H2R and all reportedisoforms of H3R before and after differentiation, at themRNA level. Based on hybridization studies, expression ofH1R and H2R was expected in NSC, but the presence ofH3R was not anticipated, due to the fact that it isexpressed from E19 onwards. H1R and H2R were detectedby immunoblot as single bands; however, H3R presentedseveral bands that varied in size between NSC and adultcerebral cortex. Similar differences in abundance andmasses have been reported between embryonic and adultbrown adipose tissue (Karlstedt et al. 2003). Bands below35 kDa are not compatible with expected sizes of G-protein coupled receptors, and might result from activeH3R degradation processing, as suggested earlier (Karlstedtet al. 2003).

In the present study, we found that HA did not modifyNSC identity during proliferation, since a high proportionof cells continue to express the intermediate filamentprotein Nestin, and therefore, HA caused a significantexpansion of NSC. Interestingly, HA could induce theappearance of a few cells positive to differentiated cellmarkers, although these cells are still Nestin-positive. Thissuggests that HA could promote premature differentiationunder proliferating conditions in a discrete population. Itremains to be investigated whether a combination of HAwith other signals could promote differentiation, even in thepresence of bFGF.

Fig. 5 Apoptosis is increased by histamine in differentiated cells.

Cells treated with increasing concentrations of HA during 6 days

showed a significant dose-dependent increase on TUNEL-positive

cells. (a) Representative micrographs of the effect of HA on TUNEL

positive cells (green, arrows), showing an increase in the proportion of

apoptotic cells normalized by the Hoechst (blue)-stained nuclei, when

compared with control cultures. Scale bar = 50 lm. (b) Concentration-

response curve for HA on TUNEL-positive cells. Data are mean ±

SEM from the combined values from cells counted from eight fields in

duplicate from three independent experiments. The line is the best-fit

estimate to a sigmoid curve. Best fit estimates for maximal effect and

EC50 are given in the results section. (*)p < 0.05 and (**)p < 0.001 vs.

control, 100 nM and 1 lM HA; (#)p < 0.05 vs. 10 lM HA.



Cell proliferation and survival are regulated by differentfactors (Kilpatrick and Bartlett 1995; Johe et al. 1996; Weisset al. 1996; Qian et al. 1997). Survival and proliferation ofearly embryonic neural precursors are regulated in vitro andin vivo by the mitogenic factors bFGF and epidermal growthfactor, among others (Kilpatrick and Bartlett 1995; Qianet al. 1997; Ciccolini and Svendsen 1998; Ortega et al.1998; Vaccarino et al. 1999). We found here that 100 lMHAwas able to increase BrdU incorporation as a measure ofcell proliferation in the presence of bFGF. This proliferatingaction of HA could be explained by second messengermediated actions of HA. It has been reported that HA is ableto increase the intracellular Ca2+concentration ([Ca2+]i) inmouse pluripotent stem cells (Bloemers et al. 1993), and

Ca2+ions are known to play an important role in proliferationby interacting with the mitogen-activated protein kinase(Bloemers et al. 1993; Berridge et al. 2000; Yanagida et al.2004).

Based on HA concentrations that have evident effects inthis study, we though that either H1R (Traiffort et al. 1994)or H2R (Garbarg and Schwartz 1987) could be implicated,since these two receptors are activated with micromolarconcentrations of HA, while H3R is activated in thenanomolar range (Chen et al. 2003; Rouleau et al. 2004)and suffer desensitization at lM concentrations (Perez-Garcia et al. 1998). We choose 100 lM HA to further studyif H1R, H2R or H3R were responsible for the effects seen onNSC proliferation and differentiation caused by HA. Theincrease of bFGF-induced proliferation caused by HA wasdue to the activation of H2R, as demonstrated by thereversion of BrdU incorporation when cells were incubatedwith 100 lM HA + 30 lM cimetidine. Although there is noreport of the effect of HA and the pathways that arestimulated by this biogenic amine on NSC, there areevidences that H2 receptor activation is linked to differentsignaling systems: 1. Stimulation of cAMP formation inbrain slices (Al-Gadi and Hill 1985), vascular smooth muscleand neutrophils (Hill 1990). 2. Stimulation of phospholipidmethylation in rat mast cells (Tolone et al. 1982). 3.Increases in the slow inward Ca2+current in several modelssuch as guinea pig ventricular myocytes, via cAMP forma-tion (Hill 1990). 4. Inhibition of Cl)-mediated K+ conduc-

(a)

(c)

(b)

(d)

Fig. 6 Histamine promotes neuronal differentiation by activation of H1

receptors. After proliferation, cells were kept on differentiating condi-

tions during 6 days and treated daily with HA. (a) Representative

micrographs of the labeling for microtubule associated protein 2

(MAP2, a mature neuronal marker shown in red), and glial fibrillar

acidic protein (GFAP, an astrocytic marker, in green) and nuclear

detection by Hoechst (in blue), showing the effect of HA on the number

of neurons and glial cells. Scale bar = 5 lm. (b) Quantification of the

total number of MAP2-positive or GFAP-positive cells in duplicate from

eight fields taken in three independent experiments. No cells were

found to co-express MAP2 and GFAP. Results are means ± SEM

expressed as the percent of total cells stained with Hoechst.

(*)p < 0.05 and (**)p < 0.001 vs. control and 100 nM HA. (c) Repre-

sentative micrographs of MAP2 (red), GFAP (green) and nuclear

detection by Hoechst (blue), showing the antagonistic effect of 1 lM

chlorpheniramine (Chlorph.) on the increase in neuronal number

caused by 100 lM HA. Scale bar = 5 lm. (d) Pharmacological anal-

ysis of HA action on NSC differentiation. HA-treated cells were incu-

bated with 1 lM of the H1R antagonist Chlorpheniramine (Chlorph.),

30 lM of the H2R antagonist cimetidine (Cimet.) or 1 lM of the H3R

blocker thioperamide (Thioper.), and the percentage of the total

number of MAP2-positive or GFAP-positive cells was quantified from

3–6 independent experiments. Results are mean ± SEM expressed

as the percent of total cells stained with Hoechst. (a) p < 0.01 of

MAP2-positive cells vs. control condition. (b) p < 0.01 GFAP-positive

cells vs. control condition.



tance in hippocampal pyramidal cells (Haas and Greene1986). 5. Increases of [Ca2+]i mobilization in a humanlymphocytic cell line (HL-60) (Mitsuhashi and Payan1991). Multiple reports demonstrated that single receptorsmay be associated with more than one G protein, and thusto multiple intracellular signaling systems (Vallar et al.1990; Van Sande et al. 1990; Gudermann et al. 1992;Raymond 1995; Arai and Charo 1996). Our results opentwo possibilities by which HA can be regulating cellproliferation by H2R activation: a) Via phosphoinositide/protein kinase C signal transduction cascade (Del Valle andGantz 1997) or b) By increasing cAMP, since this cyclicmolecule stimulate proliferation in many cell types, aneffect that is largely attributed to cross-talk from cAMP andthe mitogen-activated protein kinase pathway (Dumaz andMarais 2005). The effect of cimetidine on decreasing cellproliferation is in agreement with a study made by Finnet al., in which this H2R blocker also inhibited proliferationin three out of five glial cell lines (Finn et al. 1996).Pharmacological blockade of HA effects rules out thepossibility that this amine could be acting on the poly-amine site of the NMDA receptor, because such interactionis not susceptible to be interrupted by histaminergic H1

and H2 receptor antagonists (Bekkers 1993; Vorobjev et al.1993).

In general, stem cell pools result from the contribution ofvarious factors, i.e. rate of proliferation, time of exponentialexpansion of cell number, ratio of asymmetric to symmetriccell divisions (Caviness and Takahashi 1995), and apoptoticcell death (Blaschke et al. 1996). In the present study, wemeasured apoptotic cell death levels, in order to estimate thecontribution of this factor on the effect of HA increasing cellnumber during the proliferation phase. A low proportion ofTUNEL-positive cells was found in control NSC cultures.These results are in accordance with a study in cortical stemcells, showing low numbers of apoptotic cells (Chang et al.2004). Our data show that HA was able to further decreasethe proportion of TUNEL-positive NSC in a H2R-dependentmanner, suggesting that HA is acting both as a proliferatingand an anti-apoptotic factor for NSC in the presence ofbFGF. The effect of HA increasing cell number during theproliferation phase was not observed after 6 days of differ-entiation. This could be due to the concentration-dependentincreased in the number of TUNEL-positive cells in HA-treated cells which, together with the HA-induced increase incell number during proliferation, might account for thesimilar number of cells found in control and HA-exposedcultures. The increased cell death during differentiation couldcontribute to the neurogenic effect of HA if glial progenitors/cells are induced to undergo cell death, and this will becertainly interesting to investigate further.

About differentiation, our results show that NSC treateddaily with micromolar or low millimolar concentrations ofHA during the proliferation and differentiation stages

generate more neurons and less GFAP-positive cells. Reg-ulation of cell fate acquisition in the vertebrate CNS isdependent on the stage of development. In the rat cerebralcortex, neurogenesis begins at E12, peaks at E14, andrecedes by E17 (Sauvageot et al. 2005). In vivo, neurons aregenerated first, followed by astrocytes, and later by oligo-dendrocytes, and this behavior is mimicked by cultured NSC,that first generate neurons and then glial progeny (Qian et al.2000; Morrow et al. 2001; Panchision and McKay 2002;Sauvageot and Stiles 2002). HA concentration peaks inprosencephalon from E14 to E17 (Vanhala et al. 1994),suggesting a role of this biogenic amine in neuronaldifferentiation. The marked shift in the proportion of neuronsinduced by HA is consistent with this idea. Although HAcould contribute to neuronal differentiation in vivo, it isimportant to mention that knockout mice for the HAsynthesizing enzyme, histidine decarboxylase, do not showany evident alteration in brain development (Watanabe andYanai 2001). These results are not necessarily opposed to ourfindings, since there might be redundant mechanisms forneuronal differentiation in the cerebral cortex.

To study which histaminergic receptor is responsible forthe increase on the number of neurons in culture, weperformed experiments with H1R, H2R and H3R antagonistsand 100 lM HA. Our results show that HA increaseneuronal differentiation due to activation of H1R. Activationof this receptor leads to production of IP3 and diacylgly-cerol, that in turn promote an increase on [Ca2+]i due toactivation of IP3 receptors in the endoplasmic reticulum,and the activation of protein kinase C. Calcium release fromintracellular stores into the cytosol is a critical componentduring ontogenesis and contributes particularly to theformation and maintenance of dendritic structures (Loh-mann et al. 2002, 2005). Regarding astrocyte production, itis interesting to note that neither chlorpheniramine, norcimetidine, nor thioperamide were able to revert HA effecton decreasing glial differentiation. Notwithstanding, theoverall effect of antagonizing H1R in the presence of HA isto block its neuronal-promoting effect.

There are only a few examples of other neurotransmittershaving effects on proliferation and differentiation of NSC,and some of them are conflicting. GABA and glutamatedecrease cortical precursors proliferation (LoTurco et al.1995; Antonopoulos et al. 1997), acetylcholine increases cellproliferation (Ma et al. 2000) and dopamine has been shownto promote (Hoglinger et al. 2004) or inhibit cell prolifera-tion (Kippin et al. 2005) of adult NSC. Regarding neuro-genesis, a recent report shows that GABA has an effectpromoting this process in NSC derived from adult brain(Tozuka et al. 2005). Thus, HA is the first neurotransmittershowing a positive effect on both NSC proliferation and inthe proportion of neurons derived from cortical NSC, thatcorrelate with increased HA levels during neuronal differen-tiation in the cerebral cortex.



Acknowledgements

We thank Itzel Escobedo and Griselda Rodriguez for technical help.

This work was supported by grants IN226703 and IN224207 from

DGAPA, Universidad Nacional Autonoma de Mexico. The Nestin

monoclonal antibody developed by Dr. Hockfield was obtained from

the Developmental Studies Hybridoma Bank under the auspices of

NICHD and maintained by the University of Iowa.

References

Al-Gadi M. and Hill S. J. (1985) Characterization of histamine receptorsmediating the stimulation of cyclic AMP accumulation in rabbitcerebral cortical slices. Br. J. Pharmacol. 85, 877–888.

Antonopoulos J., Pappas I. S. and Parnavelas J. G. (1997) Activation ofthe GABAA receptor inhibits the proliferative effects of bFGF incortical progenitor cells. Eur. J. Neurosci. 9, 291–298.

Arai H. and Charo I. F. (1996) Differential regulation of G-protein-mediated signaling by chemokine receptors. J. Biol. Chem. 271,21814–21819.

Auvinen S. and Panula P. (1988) Development of histamine-immuno-reactive neurons in the rat brain. J. Comp. Neurol. 276, 289–303.

Azuma H., Sawada S., Takeuchi S., Higashiyama K., Kakigi A. andTakeda T. (2003) Expression of mRNA encoding the H1, H2, andH3 histamine receptors in the rat cochlea. Neuroreport 14, 423–425.

Bakker R. A. (2004) Histamine H3-receptor isoforms. Inflamm. Res. 53,509–516.

Bekkers J. M. (1993) Enhancement by histamine of NMDA-mediatedsynaptic transmission in the hippocampus. Science 261, 104–106.

Berridge M. J., Lipp P. and Bootman M. D. (2000) The versatility anduniversality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1,11–21.

Blaschke A. J., Staley K. and Chun J. (1996) Widespread programmedcell death in proliferative and postmitotic regions of the fetalcerebral cortex. Development 122, 1165–1174.

Bloemers S. M., Leurs R., Smit M. J., Verheule S., Tertoolen L. G.,Timmerman H. and de Laat S. W. (1993) Mouse P19 embryonalcarcinoma cells express functional histamine H1-receptors. Bio-chem. Biophys. Res. Commun. 191, 118–125.

Bonnekoh B., Wevers A., Jugert F., Merk H. and Mahrle G. (1989)Colorimetric growth assay for epidermal cell cultures by theircrystal violet binding capacity. Arch. Dermatol. Res. 281, 487–490.

Caviness Jr V. S. and Takahashi T. (1995) Proliferative events in thecerebral ventricular zone. Brain Dev. 17, 159–163.

Chang M. Y., Park C. H., Lee S. Y. and Lee S. H. (2004) Properties ofcortical precursor cells cultured long term are similar to those ofprecursors at later developmental stages. Brain Res. Dev. BrainRes. 153, 89–96.

Chen J., Liu C. and Lovenberg T. W. (2003) Molecular and pharmaco-logical characterization of the mouse histamine H3 receptor. Eur. J.Pharmacol. 467, 57–65.

Ciccolini F. and Svendsen C. N. (1998) Fibroblast growth factor 2 (FGF-2) promotes acquisition of epidermal growth factor (EGF)responsiveness in mouse striatal precursor cells: identification ofneural precursors responding to both EGF and FGF-2. J. Neurosci.18, 7869–7880.

Clapham J. and Kilpatrick G. J. (1992) Histamine H3 receptors modulatethe release of [3H]-acetylcholine from slices of rat entorhinalcortex: evidence for the possible existence of H3 receptor subtypes.Br. J. Pharmacol. 107, 919–923.

Del Valle J. and Gantz I. (1997) Novel insights into histamine H2receptor biology. Am. J. Physiol. 273, G987–G996.

Diaz N. F., Guerra-Arraiza C., Diaz-Martinez N. E., Salazar P., Molina-Hernandez A., Camacho-Arroyo I. and Velasco I. (2007) Changesin the content of estrogen alpha and progesterone receptors duringdifferentiation of mouse embryonic stem cells to dopamine neu-rons. Brain Res. Bull. 73, 75–80.

Dumaz N. and Marais R. (2005) Integrating signals between cAMP andthe RAS/RAF/MEK/ERK signalling pathways. Based on theanniversary prize of the Gesellschaft fur Biochemie und Moleku-larbiologie Lecture delivered on 5 July 2003 at the Special FEBSMeeting in Brussels. FEBS J. 272, 3491–3504.

Finn P. E., Purnell P. and Pilkington G. J. (1996) Effect of histamineand the H2 antagonist cimetidine on the growth and migrationof human neoplastic glia. Neuropathol. Appl. Neurobiol. 22,317–324.

Gantz I., Schaffer M., DelValle J., Logsdon C., Campbell V., Uhler M.and Yamada T. (1991) Molecular cloning of a gene encoding thehistamine H2 receptor. Proc. Natl Acad. Sci. USA 88, 429–433.

Garbarg T. and Schwartz J. C. (1987) Synergism between histamine H1-and H2-receptors in the cAMP response in guinea pig brain slices:effects of phorbol esters and calcium. Mol. Pharmacol. 33, 38–43.

Gudermann T., Birnbaumer M. and Birnbaumer L. (1992) Evidence fordual coupling of the murine luteinizing hormone receptor to ade-nylyl cyclase and phosphoinositide breakdown and Ca2+ mobili-zation. Studies with the cloned murine luteinizing hormonereceptor expressed in L cells. J. Biol. Chem. 267, 4479–4488.

Haas H. L. and Greene R. W. (1986) Effects of histamine on hippo-campal pyramidal cells of the rat in vitro. Exp. Brain Res. 62, 123–130.

Haas H. and Panula P. (2003) The role of histamine and the tubero-mamillary nucleus in the nervous system. Nat. Rev. Neurosci. 4,121–130.

Happola O., Ahonen M. and Panula P. (1991) Distribution of histaminein the developing peripheral nervous system. Agents Actions 33,112–115.

Heron A., Rouleau A., Cochois V., Pillot C., Schwartz J. C. and ArrangJ. M. (2001) Expression analysis of the histamine H(3) receptor indeveloping rat tissues. Mech. Dev. 105, 167–173.

Hill S. J. (1990) Distribution, properties, and functional characteristics ofthree classes of histamine receptor. Pharmacol. Rev. 42, 45–83.

Hill S. J., Ganellin C. R., Timmerman H., Schwartz J. C., Shankley N. P.,Young J. M., Schunack W., Levi R. and Haas H. L. (1997) Inter-national Union of Pharmacology. XIII. Classification of histaminereceptors. Pharmacol. Rev. 49, 253–278.

Hoglinger G. U., Rizk P., Muriel M. P., Duyckaerts C., Oertel W. H.,Caille I. and Hirsch E. C. (2004) Dopamine depletion impairsprecursor cell proliferation in Parkinson disease. Nat. Neurosci. 7,726–735.

Johe K. K., Hazel T. G., Muller T., Dugich-Djordjevic M. M. andMcKay R. D. (1996) Single factors direct the differentiation ofstem cells from the fetal and adult central nervous system. GenesDev. 10, 3129–3140.

Karlstedt K., Senkas A., Ahman M. and Panula P. (2001a) Regionalexpression of the histamine H(2) receptor in adult and developingrat brain. Neuroscience 102, 201–208.

Karlstedt K., Nissinen M., Michelsen K. A. and Panula P. (2001b)Multiple sites of L-histidine decarboxylase expression in mousesuggest novel developmental functions for histamine. Dev. Dyn.221, 81–91.

Karlstedt K., Ahman M. J., Anichtchik O. V., Soinila S. and Panula P.(2003) Expression of the H3 receptor in the developing CNS andbrown fat suggests novel roles for histamine. Mol. Cell. Neurosci.24, 614–622.

Kilpatrick T. J. and Bartlett P. F. (1995) Cloned multipotential precursorsfrom the mouse cerebrum require FGF-2, whereas glial restricted



precursors are stimulated with either FGF-2 or EGF. J. Neurosci.15, 3653–3661.

Kinnunen A., Lintunen M., Karlstedt K., Fukui H. and Panula P. (1998)In situ detection of H1-receptor mRNA and absence of apoptosis inthe transient histamine system of the embryonic rat brain. J. Comp.Neurol. 394, 127–137.

Kippin T. E., Kapur S. and van der Kooy D. (2005) Dopamine specifi-cally inhibits forebrain neural stem cell proliferation, suggesting anovel effect of antipsychotic drugs. J. Neurosci. 25, 5815–5823.

Knigge U. and Warberg J. (1991) The role of histamine in the neuro-endocrine regulation of pituitary hormone secretion. Acta Endo-crinol. (Copenh.) 124, 609–619.

Lidov H. G. and Molliver M. E. (1982) An immunohistochemical studyof serotonin neuron development in the rat: ascending pathwaysand terminal fields. Brain Res. Bull. 8, 389–430.

Lohmann C., Myhr K. L. and Wong R. O. (2002) Transmitter-evokedlocal calcium release stabilizes developing dendrites. Nature 418,177–181.

Lohmann C., Finski A. and Bonhoeffer T. (2005) Local calcium tran-sients regulate the spontaneous motility of dendritic filopodia. Nat.Neurosci. 8, 305–312.

LoTurco J. J., Owens D. F., Heath M. J., Davis M. B. and KriegsteinA. R. (1995) GABA and glutamate depolarize cortical progenitorcells and inhibit DNA synthesis. Neuron 15, 1287–1298.

Lovenberg T. W., Roland B. L., Wilson S. J., Jiang X., Pyati J., HuvarA., Jackson M. R. and Erlander M. G. (1999) Cloning and func-tional expression of the human histamine H3 receptor. Mol.Pharmacol. 55, 1101–1107.

Ma W., Maric D., Li B. S. et al. (2000) Acetylcholine stimulates corticalprecursor cell proliferation in vitro via muscarinic receptor acti-vation and MAP kinase phosphorylation. Eur. J. Neurosci. 12,1227–1240.

Matsuda N., Jesmin S., Takahashi Y. et al. (2004) Histamine H1 and H2receptor gene and protein levels are differentially expressed in thehearts of rodents and humans. J. Pharmacol. Exp. Ther. 309, 786–795.

Mezei C. and Mezei M. (1978) Ontogenesis of histamine in the chicknervous system. Neurochem. Res. 3, 573–583.

Mitsuhashi M. and Payan D. G. (1991) Multiple signaling pathways ofhistamine H2 receptors. Agents Actions Suppl. 33, 289–294.

Molina-Hernandez A., Nunez A. and Arias-Montano J. A. (2000) His-tamine H3-receptor activation inhibits dopamine synthesis in ratstriatum. Neuroreport 11, 163–166.

Molina-Hernandez A., Nunez A., Sierra J. J. and Arias-Montano J. A.(2001) Histamine H3 receptor activation inhibits glutamate releasefrom rat striatal synaptosomes. Neuropharmacology 41, 928–934.

Morrow T., Song M. R. and Ghosh A. (2001) Sequential specification ofneurons and glia by developmentally regulated extracellular fac-tors. Development 128, 3585–3594.

Nissinen M. J. and Panula P. (1995) Developmental patterns of hista-mine-like immunoreactivity in the mouse. J. Histochem. Cytochem.43, 211–227.

Nissinen M. J., Karlstedt K., Castren E. and Panula P. (1995) Expressionof histidine decarboxylase and cellular histamine-like immunore-activity in rat embryogenesis. J. Histochem. Cytochem. 43, 1241–1252.

Onodera K., Yamatodani A., Watanabe T. and Wada H. (1994) Neuro-pharmacology of the histaminergic neuron system in the brain andits relationship with behavioral disorders. Prog. Neurobiol. 42,685–702.

Ortega S., Ittmann M., Tsang S. H., Ehrlich M. and Basilico C. (1998)Neuronal defects and delayed wound healing in mice lackingfibroblast growth factor 2. Proc. Natl Acad. Sci. USA 95, 5672–5677.

Panchision D. M. and McKay R. D. (2002) The control of neural stemcells by morphogenic signals. Curr. Opin. Genet. Dev. 12, 478–487.

Perez-Garcia C., Morales L. and Alguacil L. F. (1998) Histamine H3receptor desensitization in the guinea-pig ileum. Eur. J. Pharmacol.341, 253–256.

Qian X., Davis A. A., Goderie S. K. and Temple S. (1997) FGF2concentration regulates the generation of neurons and glia frommultipotent cortical stem cells. Neuron 18, 81–93.

Qian X., Shen Q., Goderie S. K., He W., Capela A., Davis A. A. andTemple S. (2000) Timing of CNS cell generation: a programmedsequence of neuron and glial cell production from isolated murinecortical stem cells. Neuron 28, 69–80.

Raymond J. R. (1995) Multiple mechanisms of receptor-G protein sig-naling specificity. Am. J. Physiol. 269, F141–F158.

Reiner P. B., Semba K., Fibiger H. C. and McGeer E. G. (1988)Ontogeny of histidine-decarboxylase-immunoreactive neurons inthe tuberomammillary nucleus of the rat hypothalamus: time oforigin and development of transmitter phenotype. J. Comp. Neurol.276, 304–311.

Rouleau A., Heron A., Cochois V., Pillot C., Schwartz J. C. and ArrangJ. M. (2004) Cloning and expression of the mouse histamine H3receptor: evidence for multiple isoforms. J. Neurochem. 90, 1331–1338.

Sauvageot C. M. and Stiles C. D. (2002) Molecular mechanismscontrolling cortical gliogenesis. Curr. Opin. Neurobiol. 12, 244–249.

Sauvageot C., Dahia P. L., Lipan O., Park J. K., Chang M. S., AlbertaJ. A. and Stiles C. D. (2005) Distinct temporal genetic signatures ofneurogenic and gliogenic cues in cortical stem cell cultures.J. Neurobiol. 62, 121–133.

Schlicker E., Malinowska B., Kathmann M. and Gothert M. (1994)Modulation of neurotransmitter release via histamine H3 hetero-receptors. Fundam. Clin. Pharmacol. 8, 128–137.

Schwartz J. C., Barbin G., Baudry M., Garbarg M., Martres M. P.,Pollard H. and Verdiere M. (1979) Metabolism and functions ofhistamine in the brain. Curr. Dev. Psychopharmacol. 5, 173–261.

Schwartz J. C., Arrang J. M., Garbarg M., Pollard H. and Ruat M. (1991)Histaminergic transmission in the mammalian brain. Physiol. Rev.71, 1–51.

Smit M. J., Timmerman H., Alewijnse A. E., Punin M., van den Nieu-wenhof I., Blauw J., van Minnen J. and Leurs R. (1995) Visuali-zation of agonist-induced internalization of histamine H2 receptors.Biochem. Biophys. Res. Commun. 214, 1138–1145.

Specht L. A., Pickel V. M., Joh T. H. and Reis D. J. (1981) Light-microscopic immunocytochemical localization of tyrosinehydroxylase in prenatal rat brain. I. Early ontogeny. J. Comp.Neurol. 199, 233–253.

Tardivel-Lacombe J., Rouleau A., Heron A., Morisset S., Pillot C.,Cochois V., Schwartz J. C. and Arrang J. M. (2000) Cloning andcerebral expression of the guinea pig histamine H3 receptor: evi-dence for two isoforms. Neuroreport 11, 755–759.

Temple S. (2001) The development of neural stem cells. Nature 414,112–117.

Tolone G., Bonasera L. and Pontieri G. M. (1982) Histamine binding toH2 receptors stimulates phospholipid methylation in mast cells.Experientia 38, 966–968.

Tozuka Y., Fukuda S., Namba T., Seki T. and Hisatsune T. (2005)Gabaergic excitation promotes neuronal differentiation in adulthippocampal progenitor cells. Neuron 47, 803–815.

Traiffort E., Leurs R., Arrang J. M., Tardivel-Lacombe J., Diaz J.,Schwartz J. C. and Ruat M. (1994) Guinea pig histamine H1receptor. I. Gene cloning, characterization, and tissue expressionrevealed by in situ hybridization. J. Neurochem. 62, 507–518.



Vaccarino F. M., Schwartz M. L., Raballo R., Nilsen J., Rhee J., ZhouM., Doetschman T., Coffin J. D., Wyland J. J. and Hung Y. T.(1999) Changes in cerebral cortex size are governed by fibroblastgrowth factor during embryogenesis. Nat. Neurosci. 2, 246–253.

Vallar L., Muca C., Magni M., Albert P., Bunzow J., Meldolesi J. andCivelli O. (1990) Differential coupling of dopaminergic D2receptors expressed in different cell types. Stimulation of phos-phatidylinositol 4,5-bisphosphate hydrolysis in LtK- fibroblasts,hyperpolarization, and cytosolic-free Ca2+ concentration decreasein GH4C1 cells. J. Biol. Chem. 265, 10320–10326.

Van Sande J., Raspe E., Perret J., Lejeune C., Maenhaut C., Vassart G.and Dumont J. E. (1990) Thyrotropin activates both the cyclicAMP and the PIP2 cascades in CHO cells expressing the humancDNA of TSH receptor. Mol. Cell. Endocrinol. 74, R1–R6.

Vanhala A., Yamatodani A. and Panula P. (1994) Distribution of hista-mine-, 5-hydroxytryptamine-, and tyrosine hydroxylase-immuno-reactive neurons and nerve fibers in developing rat brain. J. Comp.Neurol. 347, 101–114.

Velasco I., Velasco-Velazquez M. A., Salazar P., Lajud N. and Tapia R.(2003) Influence of serum-free medium on the expression of glu-tamate transporters and the susceptibility to glutamate toxicity incultured cortical neurons. J. Neurosci. Res. 71, 811–818.

Vorobjev V. S., Sharonova I. N., Walsh I. B. and Haas H. L. (1993)Histamine potentiates N-methyl-D-aspartate responses in acutelyisolated hippocampal neurons. Neuron 11, 837–844.

Wada H., Inagaki N., Yamatodani A. and Watanabe T. (1991) Is thehistaminergic neuron system a regulatory center for whole-brainactivity? Trends Neurosci. 14, 415–418.

Watanabe T. and Yanai K. (2001) Studies on functional roles of thehistaminergic neuron system by using pharmacological agents,knockout mice and positron emission tomography. Tohoku J. Exp.Med. 195, 197–217.

Weiss S., Reynolds B. A., Vescovi A. L., Morshead C., Craig C. G. andvan der Kooy D. (1996) Is there a neural stem cell in the mam-malian forebrain? Trends Neurosci. 19, 387–393.

Yamashita M., Fukui H., Sugama K., Horio Y., Ito S., Mizuguchi H. andWada H. (1991) Expression cloning of a cDNA encoding thebovine histamine H1 receptor. Proc. Natl Acad. Sci. USA 88,11515–11519.

Yanagida E., Shoji S., Hirayama Y., Yoshikawa F., Otsu K., Uematsu H.,Hiraoka M., Furuichi T. and Kawano S. (2004) Functionalexpression of Ca2+ signaling pathways in mouse embryonic stemcells. Cell Calcium 36, 135–146.



Activated Notch1 is a stronger astrocytic stimulus

than leukemia inhibitory factor for rat neural stem cells

NIDIA S. RODRÍGUEZ-RIVERA, ANAYANSI MOLINA-HERNÁNDEZ,ERIKA SÁNCHEZ-CRUZ, DIANA ESCALANTE-ALCALDE and IVÁN VELASCO*

Departamento de Neurociencias, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, México D.F., México

ABSTRACT Neural stem cells (NSC) self-renew and generate specialized cell types. There are

reports indicating that Notch and Leukemia Inhibitory Factor (LIF) signaling are involved in cell

determination of NSC, either preventing differentiation or promoting astrocytic fate. In this work,

we aimed to compare the astrocytogenic effect of activated Notch with that induced by LIF. To this

end, rat cerebral cortex neural progenitors/NSC were transduced with retroviral vectors in order

to express green fluorescent protein (GFP), or a fusion protein of GFP with the active Notch1

intracellular domain (NICD). In parallel, other cultures were treated with increasing concentra-

tions of LIF. We confirmed, in proliferating NSC, that LIF activated intracellular effectors by

measuring STAT3 phosphorylation and Socs3 transcription. In NICD-expressing cells, Hes5 mRNA

was induced, an effect not present in GFP-transduced NSC. We quantified the proportion of cells

expressing Nestin in the presence of Fibroblast Growth Factor-2 (FGF-2) with LIF or NICD

treatments. LIF significantly increased the proportion of cells co-expresssing Nestin and Glial

Fibrillary Acidic Protein (GFAP), an effect absent in cells with activated Notch. After FGF2

withdrawal to promote differentiation, Nestin was markedly down-regulated, and neuronal and

glial markers appeared in control cultures. LIF treatment caused a significant increase in the

proportion of GFAP-positive cells, but cells expressing NICD showed a significantly higher

percentage of astrocytes than control and LIF-treated cultures. These experiments show that cells

stimulated with NICD differentiate more readily to astrocytes than LIF-treated NSC.

KEY WORDS: neural precursor, cerebral cortex, Sox2, CNTF, GFAP

Introduction

Notch is a highly conserved protein family that directs signalingmechanisms involved in proliferation and differentiation of a largenumber of cell types (Artavanis-Tsakonas et al., 1999). Notchactivation is triggered by interaction with their ligands, Delta orJagged. This union cause proteolysis of Notch, and its intracellu-lar fragment (NICD) is released to interact in the nucleus withCBF1, causing transcriptional activation of Hes genes (Corbin etal., 2008). In mammalian Central Nervous System (CNS), Notch1,2 and 3 are present in the developing neuroectoderm and thierexpression persists until adulthood (Yoon and Gaiano, 2005).Gain- and loss-of-function experiments have demonstrated thatactivated Notch1 plays an important role in preventing neuralprecursor differentiation in developing CNS, including the cere-bral cortex (Gaiano et al., 2000; Lutolf et al., 2002; Chojnacki etal., 2003; Yoon et al., 2004; Mizutani and Saito, 2005). The

Int. J. Dev. Biol. [In Press](Use DOI or consult the journal web for the definitive reference of this article)

doi: 10.1387/ijdb.092869nr

THE INTERNATIONAL JOURNAL OF

DEVELOPMENTAL

BIOLOGYwww.intjdevbiol.com

*Address correspondence to: Dr. Iván Velasco. Departamento de Neurociencias, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México.AP 70-253, México D.F. 04510, México. Fax: 5255-5622-5607. e-mail: [email protected]

Accepted: 16 January 2009. Published online: 5 March 2009. Edited by: Roberto Mayor

ISSN: Online 1696-3547, Print 0214-6282© 2009 UBC PressPrinted in Spain

Abbreviations used in this paper: CNS, central nervous system; CNTF, cilliaryneurotrophic factor; FGF-2, fibroblast growth factor-2; GAPDH,glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial fibrillary acidicprotein; GFP, green fluorescent protein; JAK, Janus kinase; LIF, leukemiainhibitory factor; LIFRβ, LIF receptor β; NSC, neural stem cells; NICD,Notch1 intracellular domain; Socs, suppressor of cytokine signaling; STAT,signal transducer and activator of transcription.

periventricular cortical zone contains dividing multipotent neuralstem cells (NSC) that self-renew and differentiate in a first phaseto neurons, later to astrocytes and finally to oligodendrocytes.Activated NICD is present only in the ventricular zone (Tokunagaet al., 2004) and Notch activity has also been shown to promoteradial glia identity (Gaiano et al., 2000). Radial glia cells expressGlial Fibrillary Acidic Protein (GFAP) and have been identified asNSC in the cerebral cortex (Noctor et al., 2001). Notch activationhas been shown to promote survival of neural precursors (Oishi

2 N.S. Rodríguez-Rivera et al.

et al., 2004; Androutsellis-Theotokis et al., 2006). Notch stimula-tion can also prevent neurogenesis of pluripotent stem cells (Nyeet al., 1994) and oligodendrocyte differentiation of glial precursors(Wang et al., 1998). Activated Notch promotes Schwann celldifferentiation from neural crest stem cells (Morrison et al., 2000),and astrocytic differentiation in NSC from developing (Grandbarbeet al., 2003) and adult CNS (Tanigaki et al., 2001).

On the other hand, Leukemia Inhibitory Factor (LIF) andCilliary Neurotrophic Factor (CNTF) are powerful inducers of NSCdifferentiation to astrocytes. These cytokines activate heteromericreceptors composed by LIF receptor β and GP130, which signalthrough activation of Janus kinase (JAK)/Signal Transducer andActivator of Transcription (STAT) pathway to promote glial com-mitment (Bonni et al., 1997; Rajan and McKay, 1998; Molne et al.,2000). STAT3 is activated by phosphorylation after LIF receptorstimulation. This pathway also causes the transcriptional activa-

tion of suppressor of cytokine signaling (Socs) 3. Socs3 associa-tion to GP130 constitutes a negative feedback loop that decreaseGP130-mediated transduction in NSC (Emery et al., 2006). Al-though the most consistent effect of LIF stimulation of NSC isgliogenesis, there is evidence that LIF, in the presence of Epider-mal Growth Factor and Fibroblast Growth Factor (FGF)-2, canincrease clonogenic potential of NSC (Pitman et al., 2004). Thus,Notch and LIF share effects on NSC, inhibiting cell differentiation,or promoting glial phenotypes. In this work we analyzed the effectof expressing NICD in rat cortical neural progenitors/NSC in vitroat a time when neurogenesis is normally favored, in order tocompare it with the action of LIF, a well-described glial differentia-tion inductor. We found that although LIF induced the expressionof the astrocytic marker GFAP during proliferation, cells that haveactivated Notch during differentiation produced a significantlyhigher proportion of GFAP-positive cells.

Fig. 1. Cortical NSC respond to LIF and CNTF stimulation. Proliferatingneural progenitors/NSC expressed Nestin (A,B) together with GP130 (A) orLIFRβ (B). In control cultures, no signal for phospho (p)STAT3 was detected(C). After addition of LIF, NSC show nuclear pSTAT3. Accordingly, inimmunoblot assays, control (CTL) cells have non-phosphorylated STAT3, and10 ng/ml CNTF or the indicated LIF concentrations induced phosphorylationof STAT3 (D). The transcriptional activation of Socs3 is only found in cellsstimulated with LIF or CNTF (E). Images are representative of 3 independentexperiments performed in duplicate. Scale bars represent 20 µm for A and 50µm for B. -RT, RNA without reverse transcriptase.

Results

NSC express receptors for LIF/CNTF and respond to appli-cation of such cytokines

In order to establish if our cortical cultures respond to LIFand CNTF stimulation, we performed immunodetection ofNestin, a filamentous protein characteristic of neural progeni-tors including NSC, together with GP130 and LIF receptor β(LIFRβ) in cells exposed to 10 ng/ml of the mitogenic agentFGF-2. Under these conditions, Nestin was expressed in 94.0± 2.3 % of cells, whereas GP130 was present in 94.7 ± 5.4 (Fig.1A) and LIFRβ (Fig. 1B) was detected in 92.2 ± 5.3 % of culturedcells. Although 10 ng/ml of LIF is enough to preserve mouseembryonic stem cells undifferentiated (Díaz et al., 2007), weperformed experiments with higher concentrations of LIF, toreach saturating concentrations in terms of GP130 / LIFRβactivation. In some instances, the effect of LIF was comparedto that of 10 ng/ml CNTF, a cytokine reported to increaseastrocytogenesis from NSC at this concentration (Johe et al.,1996). We determined STAT3 phosphorylation at tyrosine 705(pSTAT3) after a stimulation of 30 min with CNTF, or increasingconcentrations of LIF. In control conditions, we did not detectany pSTAT3 signal by immunocytochemistry, while LIF stimu-lation clearly promoted the appearance of nuclear pSTAT3(Fig. 1C); we did not find differences in the proportion of cellswith pSTAT3 when applying CNTF (42.8 ± 6.5 %) or LIF at 10ng/ml (38.2 ± 6.5 %), 25 ng/ml (38.8 ± 6.0 %) and 50 ng/ml (39.3± 6.9). Using immunoblot, we observed a similar induction inSTAT3 phosphorylation with 10 ng/ml CNTF and 10 ng/ml LIF;higher LIF concentrations increased the amount of pSTAT3(Fig. 1D). When we analyzed the induction of Socs3 transcrip-tion after stimulation of cells with cytokines for 1 h, CNTF andLIF at all tested concentrations caused similar increases inSocs3 mRNA (Fig. 1E).

NICD is found in the nucleus and activates Hes5In order to stimulate Notch signaling in NSC, we employed

retrovirus that express green fluorescent protein (GFP, control)or a fusion protein of GFP with NICD (GFP-NICD). As reportedpreviously (Yoon et al., 2004), GFP expression pattern wasdifferent in control- and NICD-transduced cells: GFP is ob-served thought the entire cell (Fig. 2A) and the fusion protein

B

C

D

E

A

Notch- and LIF-induced astroglia differentiation 3

GFP-NICD was restricted to the nucleus (Fig. 2B). We alsoexamined by RT-PCR the mRNA levels of Hes5, a Notch-acti-vated gene, and observed that Hes5 was undetectable in con-trols, and NICD promoted its transcription, indicating Notch activ-ity in such cells (Fig. 2C).

Under proliferative conditions, LIF and CNTF promote GFAPexpression

We evaluated expression of the neural progenitors/NSC markerNestin, alone or in combination with the differentiation markers β-Tubulin III and GFAP, in cells cultured with FGF-2. As alreadymentioned, in control conditions, the proportion of Nestin-positivecells was above 94 %. LIF at 10 and 50 ng/ml, and 10 ng/ml CNTF(Fig. 3 A,D) induced the appearance of cells that co-express Nestinand GFAP in numbers ranging from 20 to 40 %. These GFAP-positive cells induced by LIF treatment also express Sox2, a tran-scription factor expressed by neural progenitors including NSC: fromthe total GFAP-expressing cells, 90.11 ± 3.1 % (CNTF), 83.1 ± 6.4 %(10 ng/ml LIF), 93.8 ± 2.0 % (25 ng/ml LIF) and 89.4 ± 3.7 % (50 ng/ml LIF) were also Sox2-positive (Fig. 3B). In addition, CNTF signifi-cantly increased to 8 % the proportion of cells expressing GFAPwithout Nestin (Fig. 3D). In retroviral controls, Nestin expression wasabove 90% in the GFP-positive population, and this proportion wasnot modified in NICD-expressing cells (Fig. 3 C,D). NICD, similar toCNTF, also increased GFAP-positive cells, but did not increase thenumber of cells co-expressing Nestin and GFAP (Fig. 3D). AlthoughNICD cells express Nestin in a high proportion, it was possible toappreciate the differences in the morphology when compared with

controls: cells expressing NICD were larger, their nuclei were elon-gated and they presented long processes resembling an astrocyte-like shape (Fig. 3C).

We also analyzed if these treatments could induce prematureneuronal differentiation in cells treated with FGF-2. We found that inall tested conditions, the proportion of β-Tubulin III (detected withTUJ1 antibody), alone or in combination with Nestin, was alwaysbelow 1.5 % (Fig. 3D). Regarding transduction efficiency, in theseexperiments we confirmed that we had a similar proportion of GFP-expressing cells in GFP and NICD conditions (GFP: 7.2 ± 1.9 %;GFP-NICD: 6.1 ± 1.7 %). We also observed that in both cases, GFP+cells formed colonies, which suggest that transduced cells wereclonally derived.

NICD-expressing cells differentiate to astrocytes more effi-ciently than LIF-treated NSC

After 4-6 days of FGF-2 withdrawal, differentiation of neuralprogenitors/NSC was analyzed. We evaluated the presence of β-Tubulin III and GFAP as markers of neurons and astrocytes, respec-tively. Since we wanted to test the astrocytic-inducing activity of LIFand Notch, we decided to use cells at passage 1 because they aremore neurogenic than cells at later passages (Chang et al., 2004;Molina-Hernández and Velasco, 2008), allowing us to clearly ob-serve astrocyte differentiation. We found that under control condi-tions neural progenitors/NSC differentiate more readily to neuronsthan to astrocytes (Fig. 4 A,E). In contrast, LIF treatment at 10 (Fig.4 B,E) or 50 ng/ml (Fig. 4E) caused significant increases in thenumber of GFAP-positive cells (up to 75 %), and also a significantdecrease in neurogenesis. CNTF was only effective in decreasingthe proportion of neurons, although it augmented GFAP percentagenon-significantly from 39 % (control) to 56 % (Fig. 4E). For cellstransduced with retrovirus, we only quantified the GFP-expressingpopulation (Fig. 4 C-E). In control GFP-positive cells, there was asimilar proportion of neurons and astrocytes after differentiation (Fig.4E), whereas cells that expressed GFP-NICD presented only GFAP-positive cells, with exception of 7 cells out of 1778 assessed (0.4 %)in 8 independent experiments. Both LIF-treated and NICD-express-ing cells produced significantly more astrocytes than their respectivecontrols. However, NICD-expressing cells had a significantly higherproportion of GFAP-positive cells than LIF treatments (Fig. 4E). Toassess if Notch or JAK-STAT signaling could preserve cellsundifferentiated in the absence of FGF-2, we evaluated Nestinexpression in this differentiation phase, when this marker isnormally down-regulated. None of the experimental treatmentsused here caused cells to continue expressing Nestin, with a fewexceptions where a dim Nestin signal was detected in GFAP- orTUJ1-expressing cells (Fig. 4E).

Discussion

In the experiments presented here, we show that LIF/CNTFtreatment of proliferating neural progenitors/NSC induced co-expression of the undifferentiated neural markers Nestin andSox2, with GFAP. Notch activation did not increase significantlythe percentage of cells expressing GFAP at this stage. After FGF-2 withdrawal, both LIF and Notch caused significant increases inthe proportion of astrocytes; this side-by-side comparison showedthat Notch activation is a stronger astrocytic-promoting signalthan LIF, since practically all NICD-expressing cells differentiated

Fig. 2. Activation of Notch pathway in NSC transduced with retroviral

vectors. Proliferating neural precursors were transduced with retrovirusin the presence of FGF-2. (A) Cells incubated with control viruses expressGFP in both somata and processes. (B) Neural precursors transducedwith GFP-NICD present green fluorescence only in the nucleus. (C) Hes5mRNA is not detected in GFP-expressing cultures, but is present in NICDcells. Images are representative of 3 - 8 independent experimentsperformed in duplicate. Scale bars for A and B represent 10 µm. -RT, RNAwithout reverse transcriptase.

B

C

A


B

C

D

A

to GFAP-positive cells. The role of NICD in proliferating NSC is toprevent neuronal differentiation. It is possible that, in the absenceof FGF-2, NICD also prevents neurogenesis but not gliogenesis,allowing cells to proceed to astrocyte differentiation.

LIF and CNTF stimulate receptors that include GP130 andLIFRβ. This activation causes tyrosine phosphorylation of STAT3,which translocates to the nucleus. In our study, we show that ahigh proportion (> 90%) of cultured cells express GP130 andLIFRβ (Fig. 1 A,B). When we evaluated the presence of pSTAT330 min after LIF or CNTF addition, we found a smaller proportion

(< 43%) of positive cells (Fig. 1C), indicating that not all neuralprogenitors/NSC are equally responsive to LIF/CNTF application.As previously reported (Emery et al., 2006), we observed nuclearpSTAT3 and Socs3 transcriptional activation after LIF and CNTFstimulation of NSC. We did not find significant differences in theproportion of cells expressing pSTAT3 by immunocytochemistrynor in Socs3 induction by RT-PCR. In Western blot, we found thathigh LIF concentrations were more effective than CNTF and 10ng/ml LIF in phosphorylating STAT3. This effect seems to bepreserved when we analyzed the percentage of cells co-express-

Fig. 3. LIF and CNTF treatment of proliferating NSC causes

Nestin/GFAP co-expression. Cortical neural precursors were incu-bated with 10 ng/ml FGF-2, alone or in the presence of 10 or 50 ng/mlof LIF, or 10 ng/ml CNTF. Also, GFP and GFP-NICD transduced cellswere incubated with FGF-2. Nestin and Sox2 (neural progenitor/NSCmarkers), GFAP (astrocytic marker) and β-Tubulin III (neuronal proteinrecognized by TUJ1 antibody) expression was evaluated in theseconditions. Control cells showed very rarely differentiation markers(A,D). Treatments with 10 ng/ml LIF (A), 50 ng/ml LIF or 10 ng/mlCNTF (D) caused significant increases in GFAP expression withoutNestin (NEST) down-regulation. GFAP-positive cells after LIF treat-ment express Sox2 (B). GFP-expressing cells were also Nestin-positive in a high proportion (C,D). Expression of GFP-NICD by neuralprecursors (C) did not induce GFAP expression in Nestin positivecells. Several Nestin+ NICD-expressing cells showed flat and largecell somata, resembling astrocyte-like morphologies (C). Images arerepresentative of 3 independent experiments performed in duplicate.The plot shows means ± standard error of 4-8 independent experiments.* P < 0.05, ** P < 0.01 and *** P < 0.001 versus control condition. # P< 0.05 versus GFP cells. Scale bars represent 25 µm in A, 100 µm in Band 50 µm in C.

ing GFAP and Nestin. However, 10 or 50 ng/ml LIF wereequally effective in inducing astrocyte differentiation in theabsence of FGF-2 (Fig. 4E). Co-expression of GFAP in Nestin-positive cells after LIF/CNTF treatment is not indicative of glialcommitment, as demonstrated by the high proportion of GFAPcells that express Sox2 (Fig. 3B). This Nestin/GFAP co-expression is probably mediated by transcriptional activationof the Gfap promoter by pSTAT3, and did not involve dramaticchange in cell shape. In contrast, NICD-expressing cellspresent clear changes in cell size and shape, reminiscent ofastrocyte morphology, even when they do not express GFAPand remain Nestin- (Fig. 3C) and Sox2-positive (data notshown).

NSC in culture recapitulate to some extent the differentia-tion compromise described in vivo (Qian et al., 2000; Sauvageotand Stiles, 2002; Chang et al., 2004): early NSC are moreprone to produce neurons, whereas older NSC produce glia(astrocytes first and oligodendrocytes later). In our controlcultures, we found that cells differentiate preferentially toneurons. As described earlier, LIF treatment (Molne et al.,2000) and Notch activation (Morrison et al., 2000; Chamberset al., 2001; Grandbarbe et al., 2003) switched this differentia-tion potential to an astrocytic one. Exposure of NSC to CNTFinduced Notch1 expression (Chojnacki et al., 2003) withoutactivating expression of Notch-responsive genes such as Hes(Chojnacki et al., 2003; Androutsellis-Theotokis et al., 2006).CNTF/LIF effects are mediated through tyrosine 705 phospho-rylation in STAT3. However, phosphorylation of serine residue727 of STAT3 has been reported after Jagged1 addition to


NSC. Furthermore, Jagged1 stimulation of Hes3 expression inmouse neural precursors is reverted by CNTF exposure(Androutsellis-Theotokis et al., 2006). Also, it has been reportedthat an active form of Notch activates STAT-dependent promot-ers, and that this activation is facilitated by Hes1 and Hes5.Dominant negative forms of STAT3 repressed such Hes-medi-ated transcriptional activation (Kamakura et al., 2004). These

Fig. 4. Activated Notch1 is a stronger astrocyte inductor than LIF for

cortical NSC. Cells in the conditions described in Fig. 3 were allowed todifferentiate for 4-6 days after FGF-2 withdrawal. Neural progenitor/NSC(Nestin), neuronal (β-Tubulin III, detected by TUJ1 antibody) and astro-cytic markers (GFAP) were quantified. In retroviral-treated cultures, onlythe GFP-expressing population was analyzed. In control cultures, neuralprogenitors/NSC produced more neurons than astrocytes (A,E). Treat-ment with 10 (B) or 50 ng/ml LIF (E) significantly switched theseproportions to astrocyte differentiation. In control GFP cells, neuronal andglial differentiation did not differ from control conditions (C,E). In C, GFPcells that express GFAP are labeled with arrows, and GFP+ / β-Tubulin III+cells are indicated by arrowheads. In the case of GFP-NICD cells,practically all cells express GFAP (D,E). This latter condition was signifi-cantly different from both GFP/control and LIF treatments. Nestin (NEST)-positive cells are very rarely observed in these conditions (E). Data wereobtained from 4-8 independent experiments performed in duplicate. Thegraph shows means ± standard error. * P < 0.05 and *** P < 0.001 versuscontrol condition. # P < 0.05 versus GFP cells. ∧ P < 0.05 compared to LIF-treated cells. Scale bars, 25 µm.

results start revealing the complex scenario in which NSC mightbe immerse, and suggest potential crosstalk between pathwaysactivated by LIF and Notch. Cultured neural progenitors/NSChave been valuable to molecularly dissect important pathwaysthat might be important in brain development.

Recently, similar to what is observed after GFP-NICD retroviralinjection in developing CNS, activated forms of FGF receptorshave been show to promote NSC identity and self-renewal in earlyprecursors (Yoon et al., 2004). We have used the same retroviralvectors to express the active form of Notch1 in cortical cells. Theresults reported here might seem conflicting with the fact that thisgroup found that neural precursors transduced in vivo with GFP-NICD, and isolated later by fluorescence activated cell sorting,were enriched in neurosphere-forming capacity and later wereable to differentiate to neurons, astrocytes and oligodendrocytes.However, neurons and oligodendrocytes were present in cellsthat lost GFP-NICD expression. In the present set of experiments,we analyzed only cells that kept the Notch pathway active. Indifferentiated GFP-NICD expressing cells, GFAP expression wasclear in over 99% of cells, and we did not detect Nestin in suchGFAP-positive cells (Fig. 4E). There is a possibility for retroviralsilencing in our experiments, but this putative population was notanalyzed, since only GFP-expressing cells were considered. It isalso worth to mention that the retroviral approach used in thisstudy might select for rapidly dividing cells, while slow-dividingand quiescent cells are not infected, and thus these latter popu-lations were not analyzed here. After differentiation, GFP-trans-duced cells show non-significant deviations from non-transducedcontrols in neuronal and astroglial differentiation, which mightreflect subtle differences between these cell populations. Inconclusion, our results show that neural progenitors/NSC re-spond to both LIF and NICD by differentiating to astrocytes.However, in the population that continues to express GFP-NICDglial differentiation is almost 100 % efficient.

Materials and Methods

Retroviral vectorsWe produced non-replicative retroviruses using the Pantropic Retroviral

Expression System (Clontech), by transient co-transfection of GP2-293packaging cells with plasmids coding the envelope protein VSV-G and theDNA of choice, as described earlier (Gaiano et al., 1999; Yoon et al.,2004). Virus containing the coding sequence for GFP alone (GIA plas-mid), and retrovirus that has GFP fused in frame to amino acids 1761 to2531 from the intracellular Notch1 domain (GFP-NICD, GNIA vector)were made. These constructs were reported to be expressed in NSC invivo, and the fusion protein GFP-NICD can activate downstream Notchtargets (Gaiano et al., 1999; Yoon et al., 2004).

To verify that retroviruses were assembled correctly and were infec-tive, we made control-assembling (G-Luc) virus by transfecting VSV-Gplasmid into a packaging cell line stably transfected with the luciferasegene (GP2-293-Luc), provided with the pantropic kit. Supernatants ofVSV-G transfected GP2-293-Luc cells were pooled and concentrated byultracentrifugation (2 h at 82 000 x g at 4°C). Ten microliters of G-Luc viruswere added to 60-70% confluent NIH 3T3 10-cm dishes, incubated at37°C with 5% of CO2 for 2 days and then protein was extracted with lysisbuffer (NaCl 150 mM, Tris-HCl 20 mM, DTT 1 mM, Triton X-100 1%, and1X Roche protease inhibitors, pH 7.2). Untransduced NIH 3T3 cells wereused as negative controls. We performed luciferase assays at roomtemperature with 200 µl of each sample, mixing them with 200 µl of assaybuffer (Tricine 30 mM, DTT 10 mM, ATP 3 mM, MgSO4 15 mM, pH 7.8)

B

C D

A

E


and 200 µl of D-Luciferin (Sigma) 1 mM, pH 6.5 just before being placedon a luminometer. A solution of assay buffer with D-Luciferin was used asblank. Luciferase activity was corrected by protein concentration deter-mined by the Bradford assay. Bioluminescence was calculated as relativelight units (RLU) / µg of protein. Under these conditions, we confirmed thatinfective retrovirus were being produced, since untransduced fibroblastshad 0.06 RLU / µg of protein and G-Luc virus presented an activity of 48.29RLU / µg of protein.

After confirming viral production and infectivity, GFP and GFP-NICDvirus were produced, concentrated and titrated using the plaque method,where serial dilutions of viral suspension were incubated with NIH 3T3fibroblast to determine the number of GFP colonies present in eachdilution calculating the number of colony forming units (c.f.u.) per ml.Titers for different viral lots were between 3.5 X 104 - 4.4 X 105 c.f.u. / ml.In fibroblast cultures exposed to control retrovirus, GFP could be ob-served throughout the cell, whereas in GFP-NICD cells, GFP expressionwas restricted to the nucleus.

NSC primary cultures and retroviral transductionNeural progenitors/NSC were obtained by dissecting the brain cortical

region from embryonic day 14 Wistar rat embryos using publishedprotocols (Johe et al., 1996; Molina-Hernández and Velasco, 2008). Allembryos and cortices were maintained on ice-cold Krebs solution. Dis-sected cortical tissue was centrifuged 5 minutes at 200 x g. The superna-tant was discarded and the pellet was re-suspended in 1 ml of N2 medium(DMEM/F12 1:1, supplemented with 25 µg/L of human insulin, 30 nMsodium selenite, 100 µM putrescine, 20 nM progesterone and 100 mg/lapotransferrin) to mechanically dissociate it using a P1000 micropipettetip. The single-cell suspension was recovered and pellet was re-sus-pended again in 1 ml of N2 medium to repeat pipette tip passages.Undissociated tissue was let to settle and discarded. Single cells werecentrifuged at 200 x g for 5 min at 4°C. Cells were counted and seededat 1 - 1.4 x 106 in 10-cm diameter culture dishes treated with 15 µg/ml poli-L-ornithine (PLO), and 1 µg/ml Fibronectin in N2 with 10 ng/ml of FGF-2to promote proliferation, and incubated at 37°C with 5% of CO2. FGF-2was added daily and N2 medium was changed every other day.

At a confluence of around 80%, neural progenitors/NSC were passedto glass coverslips (Assistent, Germany) also treated with PLO/fibronectinin 24-well plates at a density of 1 x 104 cells per well. When cultures were50% confluent, NSC were transduced with the viral vectors. We decidedto work with low titers in order to be able to quantify transduction efficiencyaccurately, and to better evaluate differentiation of transduced cells.Viruses were left in contact with NSC during 2 days. After that time, mediawas changed for fresh N2 with FGF-2 and cells were left in theseproliferative conditions during 4 more days. After this time, half of thecoverslips in each condition were fixed with 4% paraformaldehyde inphosphate-buffered saline (PBS) for 20 min and saved for posterioranalysis. Media was changed for the rest of the cultures to N2 with 200 µMascorbic acid to promote differentiation. This condition was sustainedduring 4-6 additional days, changing medium every other day. Afterdifferentiation, cells were fixed for 20 minutes with cold 4% paraformalde-hyde/PBS. Additionally, we treated cells with 10 ng/ml (equivalent to 1000U/ml), 25 ng/ml or 50 ng/ml of LIF daily, or with 10 ng/ml CNTF, andincluded a control condition without any virus nor LIF/CNTF. These laterconditions were fixed at the same time points than the viral transductions.

Electrophoresis and Western blotWe performed immunoblots as described (Diaz et al., 2007; Molina-

Hernández and Velasco, 2008) using the Phospho-STAT3 kit from CellSignaling following the recommendations provided by the manufacturer.Briefly, neural progenitors/NSC were grown to subconfluency and stimu-lated with CNTF or LIF for 30 min. Cells were homogenized in lysis buffersupplemented with protease and phosphatase inhibitors (Roche, Ger-many). Proteins were obtained by centrifugation at 15,000 rpm at 4°C for15 min, and supernatant was quantified by a modified Bradford assay

(BioRad, Germany). Proteins (40 µg) were resolved on 8% SDS-PAGEand transferred to nitrocellulose membranes (Amersham Bioscience,USA) which were blocked with 5% non-fat dry milk and incubatedovernight with primary antibodies. Pre-stained markers (Invitrogen) wereincluded for size determination. Membranes were washed and incubatedwith corresponding horseradish peroxidase-coupled secondary antibod-ies (Santa Cruz Biotechnology). Bands were detected using enhancedchemiluminescence (Amersham) and film exposure. Membranes werestripped for reproving using a commercial solution (Chemicon).

RNA extraction and RT-PCRTotal RNA was isolated from cells stimulated for 1 h with LIF or CNTF,

using TRIZOL (Invitrogen). One µg of total RNA was reverse transcribedwith random hexamers and 2 µl from the reaction were used in PCRcontaining 2 U Taq DNA polymerase (Invitrogen), 20 pmol of specificprimers (Sigma) and 500 mM deoxynucleoside triphosphates. The se-quence of the primer used is as follows (5´ to 3´orientation): glyceralde-hyde 3-phosphate dehydrogenase(GAPDH) sense: ATCACCATCTTCCAGGAGCG;GAPDH antisense: CCTGCTTCACCACCTTCTTG;Hes5 sense: ATGGCCCCAAGTACCGTGGCG;Hes5 antisense: TCACCAGGGCCGCCAGAGGC;Socs3 sense: ACCAGCGCCACTTCTTCACA;Socs3 antisense: GTGGAGCATCATACTGGTCC. The conditions usedwere: Socs3: denaturalization at 95°C for 5 min, 30 cycles at 95°C for 40s, annealing at 58°C for 30 s, and elongation at 72°C for 40 s. For Hes5:denaturalization at 94°C for 5 min, 35 cycles at 94°C for 30 s, annealingat 63°C for 30s, and elongation at 72°C for 2 min. For GAPDH: denatu-ralization at 95°C for 15 min, 30 cycles of denaturalization at 95°C for 1min, annealing at 62°C for 1 min, and elongation at 72°C for 1 min. In allcases, final extension at 74°C for 10 min was terminated by rapid coolingat 4°C. PCR products were analyzed in 2% agarose gel electrophoresisand the size of the reaction products was determined by comparison withmolecular weight standards after ethidium bromide staining. As a nega-tive control, reactions with RNA in the absence of retrotranscription wereincluded (-RT in figures).

ImmunocytochemistryReported procedures were followed (Velasco et al., 2003; Diaz et al.,

2007). In brief, fixed cells were blocked in 10% normal goat serum(Microlab, México) and permeabilized with 0.3% Triton X-100 in PBS.Immunocytochemistry was performed with antibodies for GFP (rabbit,Molecular Probes; mouse, Q-BIO gene) to identify transduced cells.Other cell markers were immunodetected with the following antibodies:Nestin (Developmental Studies Hybridoma Bank), β-Tubulin-III (mouseor rabbit TUJ1, Covance), GFAP (rabbit, DAKO; rat, Zymed), pSTAT3(Cell Signaling), Sox2 (Chemicon), GP130 (Santa Cruz Biotechnology)and LIFRβ (Santa Cruz Biotechnology). Primary antibodies were dilutedin blocking solution and left at 4°C overnight. After that, cells were washed3 times with PBS, secondary antibodies were applied in a 1:500 dilution,and left 2 h at room temperature. Goat secondary antibodies coupled toAlexa 350, 488, or 568 (Molecular Probes), or FITC (Southern Biotechnol-ogy) were used. Slides were washed again with PBS, and in some cases,nuclei were stained with 1 ng/ml of Hoechst 33258 (Sigma) in PBS during10 minutes before being mounted with Aqua Poly/Mount (PolysciencesInc). In all experiments, fixed cells were incubated in the absence ofprimary antibodies to rule out unspecific staining.

Microscopy and statistical analysisFluorescence was observed with an epifluorescence microscope

(Nikon Eclipse) and images were digitalized with a high resolution camera(Nikon DMXF10) and analyzed later. Pictures of each fluorophore weretaken as a color channel and mixed using Adobe Photoshop 7.0. In somecases, an Olympus confocal microscope was used. Four to 10 fields percondition were used to quantify the number of cells expressing the


different cell markers and/or GFP according to each condition using theprogram ImageJ 1.34s (NIH, USA). All data were obtained from at least3 independent experiments performed in duplicate. The mean of theexperiments ± standard error were plotted using the program Graph PadPrism 2.01 and the statistical analysis was performed using ANOVA andStudent-Newman-Keuls test with 95% of confidence (WINKS 4.80a;TexaSoft).

AcknowledgementsWe thank Dr. Nicholas Gaiano (Johns Hopkins University) for provid-

ing plasmids and advice on retroviral production, Dr. Yvonne Rosensteinand Dr. Gabriel Gutierrez-Ospina for providing antibodies, Israel Lopezfrom Universidad Autónoma de Ciudad Juárez and Gabriel Orozco fromthe Microscope Unit for technical help, Dr. Felix Recillas for the use of hisluminometer, and all collaborators from the Velasco lab for their continu-ous support. N. S. R.-R. and E. S.-C. were supported by fellowships fromUniversidad Nacional Autónoma de México and Conacyt. This work wassupported by PAPIIT grants IN226703 and IN224207 from UniversidadNacional Autónoma de México.

References

ANDROUTSELLIS-THEOTOKIS, A., LEKER, R.R., SOLDNER, F., HOEPPNER,D.J., RAVIN, R., POSER, S.W., RUEGER, M.A., BAE, S.K., KITTAPPA, R. andMCKAY, R.D. (2006) Notch signalling regulates stem cell numbers in vitro andin vivo. Nature 442: 823-826.

ARTAVANIS-TSAKONAS, S., RAND, M.D. and LAKE, R.J. (1999) Notch signaling:cell fate control and signal integration in development. Science 284: 770-776.

BONNI, A., SUN, Y., NADAL-VICENS, M., BHATT, A., FRANK, D.A., ROZOVSKY,I., STAHL, N., YANCOPOULOS, G.D. and GREENBERG, M.E. (1997) Regula-tion of gliogenesis in the central nervous system by the JAK-STAT signalingpathway. Science 278: 477-483.

CHAMBERS, C.B., PENG, Y., NGUYEN, H., GAIANO, N., FISHELL, G. and NYE,J.S. (2001) Spatiotemporal selectivity of response to Notch1 signals in mamma-lian forebrain precursors. Development 128: 689-702.

CHANG, M.Y., PARK, C.H., LEE, S.Y. and LEE, S.H. (2004) Properties of corticalprecursor cells cultured long term are similar to those of precursors at laterdevelopmental stages. Brain Res. Dev. Brain Res. 153: 89-96.

CHOJNACKI, A., SHIMAZAKI, T., GREGG, C., WEINMASTER, G. and WEISS, S.(2003) Glycoprotein 130 signaling regulates Notch1 expression and activationin the self-renewal of mammalian forebrain neural stem cells. J. Neurosci. 23:1730-1741.

CORBIN, J.G., GAIANO, N., JULIANO, S. L., POLUCH, S., STANCIK, E. andHAYDAR, T. F. (2008) Regulation of neural progenitor cell development in thenervous system. J. Neurochem. 106: 2272-2287.

DIAZ, N.F., GUERRA-ARRAIZA, C., DIAZ-MARTINEZ, N.E., SALAZAR, P.,MOLINA-HERNANDEZ, A., CAMACHO-ARROYO, I. and VELASCO, I. (2007)Changes in the content of estrogen alpha and progesterone receptors duringdifferentiation of mouse embryonic stem cells to dopamine neurons. Brain Res.Bull. 73: 75-80.

EMERY, B., MERSON, T.D., SNELL, C., YOUNG, K.M., ERNST, M. andKILPATRICK, T.J. (2006) SOCS3 negatively regulates LIF signaling in neuralprecursor cells. Mol. Cell. Neurosci. 31: 739-747.

GAIANO, N., KOHTZ, J.D., TURNBULL, D.H. and FISHELL, G. (1999) A method forrapid gain-of-function studies in the mouse embryonic nervous system. Nat.Neurosci. 2: 812-819.

GAIANO, N., NYE, J.S. and FISHELL, G. (2000) Radial glial identity is promoted byNotch1 signaling in the murine forebrain. Neuron 26: 395-404.

GRANDBARBE, L., BOUISSAC, J., RAND, M., HRABE DE ANGELIS, M.,ARTAVANIS-TSAKONAS, S. and MOHIER, E. (2003) Delta-Notch signalingcontrols the generation of neurons/glia from neural stem cells in a stepwiseprocess. Development 130: 1391-1402.

JOHE, K.K., HAZEL, T.G., MULLER, T., DUGICH-DJORDJEVIC, M.M. and MCKAY,R.D. (1996) Single factors direct the differentiation of stem cells from the fetaland adult central nervous system. Genes Dev. 10: 3129-3140.

KAMAKURA, S., OISHI, K., YOSHIMATSU, T., NAKAFUKU, M., MASUYAMA, N.and GOTOH, Y. (2004) Hes binding to STAT3 mediates crosstalk betweenNotch and JAK–STAT signalling. Nat. Cell Biol. 6: 547-554.

LUTOLF, S., RADTKE, F., AGUET, M., SUTER, U. and TAYLOR, V. (2002) Notch1is required for neuronal and glial differentiation in the cerebellum. Development129: 373-385.

MIZUTANI, K. and SAITO, T. (2005) Progenitors resume generating neurons aftertemporary inhibition of neurogenesis by Notch activation in the mammaliancerebral cortex. Development 132: 1295-1304.

MOLINA-HERNÁNDEZ, A. and VELASCO, I. (2008) Histamine induces neuralstem cell proliferation and neuronal differentiation by activation of distincthistamine receptors. J. Neurochem. 106: 706-717.

MOLNE, M., STUDER, L., TABAR, V., TING, Y.T., EIDEN, M.V. and MCKAY, R.D.(2000) Early cortical precursors do not undergo LIF-mediated astrocytic differ-entiation. J. Neurosci. Res. 59: 301-311.

MORRISON, S.J., PEREZ, S.E., QIAO, Z., VERDI, J.M., HICKS, C., WEINMASTER,G. and ANDERSON, D.J. (2000) Transient Notch activation initiates an irrevers-ible switch from neurogenesis to gliogenesis by neural crest stem cells. Cell 101:499-510.

NOCTOR, S.C., FLINT, A.C., WEISSMAN, T.A., DAMMERMAN R.S. andKRIEGSTEIN, A.R. (2001) Neurons derived from radial glia cells establish unitsin neocortex. Nature 409: 714-720.

NYE, J.S., KOPAN, R. and AXEL, R. (1994) An activated Notch suppressesneurogenesis and myogenesis but not gliogenesis in mammalian cells. Devel-opment 120: 2421-2430.

OISHI, K., KAMAKURA, S., ISAZAWA, Y., YOSHIMATSU, T., KUIDA, K.,NAKAFUKU, M., MASUYAMA, N. and GOTOH, Y. (2004) Notch promotessurvival of neural precursor cells via mechanisms distinct from those regulatingneurogenesis. Dev. Biol. 276: 172-184.

PITMAN, M., EMERY, B., BINDER, M., WANG, S., BUTZKUEVEN, H. andKILPATRICK, T.J. (2004) LIF receptor signaling modulates neural stem cellrenewal. Mol. Cell. Neurosci. 27: 255-266.

QIAN, X., SHEN, Q., GODERIE, S.K., HE, W., CAPELA, A., DAVIS, A.A. andTEMPLE, S. (2000) Timing of CNS cell generation: a programmed sequence ofneuron and glial cell production from isolated murine cortical stem cells. Neuron28: 69-80.

RAJAN, P. and MCKAY, R.D. (1998) Multiple routes to astrocytic differentiation inthe CNS. J. Neurosci. 18: 3620-3629.

SAUVAGEOT, C.M. and STILES, C.D. (2002) Molecular mechanisms controllingcortical gliogenesis. Curr. Opin. Neurobiol. 12: 244-249.

TANIGAKI, K., NOGAKI, F., TAKAHASHI, J., TASHIRO, K., KUROOKA, H. andHONJO, T. (2001) Notch1 and Notch3 instructively restrict bFGF-responsivemultipotent neural progenitor cells to an astroglial fate. Neuron 29: 45-55.

TOKUNAGA, A., KOHYAMA, J., YOSHIDA, T., NAKAO, K., SAWAMOTO, K. andOKANO, H. (2004) Mapping spatio-temporal activation of Notch signalingduring neurogenesis and gliogenesis in the developing mouse brain. J.Neurochem. 90: 142-154.

VELASCO, I., VELASCO-VELAZQUEZ, M.A., SALAZAR, P., LAJUD, N. andTAPIA, R. (2003) Influence of serum-free medium on the expression of glutamatetransporters and the susceptibility to glutamate toxicity in cultured corticalneurons. J. Neurosci. Res. 71: 811-818.

WANG, S., SDRULLA, A.D., DISIBIO, G., BUSH, G., NOFZIGER, D., HICKS, C.,WEINMASTER, G. and BARRES, B.A. (1998) Notch receptor activation inhibitsoligodendrocyte differentiation. Neuron 21: 63-75.

YOON, K. and GAIANO, N. (2005) Notch signaling in the mammalian centralnervous system: insights from mouse mutants. Nat. Neurosci. 8: 709-715.

YOON, K., NERY, S., RUTLIN, M.L., RADTKE, F., FISHELL, G. and GAIANO, N.(2004) Fibroblast growth factor receptor signaling promotes radial glial identityand interacts with Notch1 signaling in telencephalic progenitors. J. Neurosci.24: 9497-9506.


Further Related Reading, published previously in the Int. J. Dev. Biol.

See our recent Special Issue Stem Cells and Transgenesis, edited by Robert E. Hammer and Richard R. Behringer at:http://www.ijdb.ehu.es/web/contents.php?vol=42&issue=7

Notch-Off: a perspective on the termination of Notch signallingRita Fior and Domingos Henrique

Int. J. Dev. Biol. (2009) In Press

Neural stem cells at the crossroads: MMPs may tell the wayGaetana A. Tonti, Ferdinando Mannello, Emanuele Cacci and Stefano BiagioniInt. J. Dev. Biol. (2009) 53: 1-17

Neural differentiation from human embryonic stem cells in a definedadherent culture conditionHossein Baharvand, Narges-Zare Mehrjardi, Maryam Hatami, Sahar Kiani,Mahendra Rao and Mahdi-Montazer HaghighiInt. J. Dev. Biol. (2007) 51: 371-378

Notch in vertebrates - molecular aspects of the signalKen-Ichi Katsube and Kei SakamotoInt. J. Dev. Biol. (2005) 49: 369-374

Distinct neural precursors in the developing human spinal cordSally Walder and Patrizia FerrettiInt. J. Dev. Biol. (2004) 48: 671-674

Notch activity is required to maintain floorplate identity and to controlneurogenesis in the chick hindbrain and spinal cordIsabelle le Roux, Julian Lewis and David Ish-HorowiczInt. J. Dev. Biol. (2003) 47: 263-272

2006 ISI **Impact Factor = 3.577**

Logros académicos

Desde la licenciatura he estado interesada en mi formación como investigadora, en este periodo realice una estancia de investigación en el departamento de Fisiología Biofísica y Neurociencias con el Dr. Jorge Hernández (CINVESTAV-IPN). Durante la realización de la maestría y el doctorado en el mismo departamento bajo la tutoría del Dr. José Antonio Arias Montaño, fueron publicados 2 artículos, siendo estos de los primeros reportes en donde se demuestra la función inhibidora de la activación del receptor histaminèrgico H3 sobre la síntesis y liberación de neurotransmisores, contribuyendo al conocimiento de la función de este receptor, siendo actualmente el foco para el desarrollo de fármacos con gran potencial terapéutico.

Realice una estancia posdoctoral en Francia de la cual aún no se ha publicado nada debido a que el trabajo se realizó sobre el estudio de un fármaco en desarrollo con propósitos terapéuticos para la obesidad. Desde mi regreso a finales del 2004 he publicado en conjunto con el Dr. Velasco 3 artículos internacionales en revistas indexadas, un artículo de divulgación científica y 1 memoria en extenso.

Además he escrito de 9 capítulos de libro, 8 nacionales y 1 internacional, de los cuales cuatro figuro como único autor y 5 en colaboración.

He participado en comités tutórales y exámenes de grado, como invitada en cursos y conferencias de programas de licenciatura, maestría y doctorado. Y recientemente como revisora de proyectos CONACYT

He realizado estancias cortas en laboratorios nacionales e internacionales, Gracias a mi propuesta realizada a mi regreso del postdoctorado sobre el papel de

la histamina durante el desarrollo, y al trabajo publicado en el Journal of Neurochemistry “Histamine induces neural stem cell proliferation and neuronal differentiation by activation of distinct histamine receptors”, he abierto una nueva línea de investigación siendo este trabajo el primer en reportar la relevancia de la histamina durante el desarrollo del sistema nervioso central en un estudio in vitro, abriendo nuevas perspectivas sobre las funciones de esta amina durante el desarrollo. Este trabajo al ser presentado en el “XXXVI Meeting of European Histamine Research Society”, con el título “Effect of histamine on cell proliferation, apoptotic death and cell differentiation in cultured cortical neural stem cells, on the way to study the histaminergic role during cerebral cortex development” obtuvo una mención honorífica en el concurso de carteles.

En total he participado en la publicación de 6 artículos en revistas internacionales con un aproximado de 58 citas. De los artículos publicados aparezco en 50% como primer autor.

Durante mi trayectoria académica he sido honrada con diversas becas del CONACYT, para realizar estudios de postgrado a nivel Maestría y Doctorado, además de 1 año de apoyo económico para realizar estancia posdoctoral. Por último es importante mencionar que gracias a los logros obtenidos actualmente soy nivel I en el Sistema Nacional de Investigadores.

Propuesta de trabajo La histamina (HA) funciona como un neurotransmisor/neuromodulador (NT/NM) en el sistema nervioso central de los mamíferos adultos, este NT/NM es sintetizado a partir del aminoácido histidina por acción de la descarboxilasa de histidina.

Entre las funciones más destacadas de la HA en el sistema nervioso central se encuentran [1]: A.- Posible papel en el desarrollo del SNC (propuesto por mi) B.- Conductas alimentarías C.- Sueño y vigila D.- Regulación autónoma y neuroendócrina E.- Termorregulación F.- Presión arterial G.- Conducta motora H.- Ritmos circádicos

El programa de trabajo consistirá en estudiar el efecto de la HA en el desarrollo del sistema nervioso central tanto en animales sanos, como los fetos de madres obesas y/o diabéticas, estudiar la relación de esta amina con otros factores que intervienen en el desarrollo del sistema nervioso central, en particular de la corteza cerebral (sin descartar otras áreas del cerebro) utilizando modelos in vitro e in vivo.

Estudiar los mecanismos de acción de la histamina durante el desarrollo del Sistema Nervioso Central, la farmacología de sus receptores durante el desarrollo.

Se sabe que la HA es uno de los primeros neurotransmisores en aparecer en el SNC en desarrollo de los vertebrados y que su concentración es mucho mas elevada que en el SNC del adulto. En 1989 Panula y colaboradores reportaron que el cerebro y el tejido periférico de fetos contienen 5-7 veces más HA que el animal adulto, además de contar con distintos sistemas neuronales y no neuronales para su almacenamiento. Estos estudios también muestran que la distribución de la inmunoreactividad contra la HA presenta diferencias fundamentales en el tejido periférico de la rata y el ratón, y que por otro lado la inmunoreactividad contra este NM/NT en el SNC es muy similar en las dos especies [2-5], y que no es sino hasta los días embrionarios 20 (E20) y 19 (E19) que las neuronas histaminérgicas se localizan en el núcleo tuberomamilar del cerebro de la rata y el ratón respectivamente y la distribución característica que presentan las fibras histaminérgicas en el adulto se da hasta el día postnatal 14 (P14) [5].

Los subgrupos de células identificados durante el desarrollo tienen una localización diferente a la encontrada en el adulto. Así pues tenemos que durante el desarrollo entre los días E13 al E18 en la rata [6] y el E13 al E15 en el ratón tanto la histamina como la expresión de la HD están presentes en el romboencéfalo (núcleo del rafe) [2]. Por otro lado entre los días E14 al E18 se ha observado la expresión de la HD en el plexo coroide, los ventrículos laterales, y los ventrículos terceros y cuartos. Estos datos indican que existe una síntesis local de histamina en diferentes áreas del cerebro durante el desarrollo, lo cual podría tener gran importancia para la buena estructuración del SNC de manera general o en zonas específicas del cerebro. Además, durante los días antes mencionados no solo se logran identificar células inmunoreactivas a HA sino que además el cerebro en desarrollo experimenta elevaciones en la concentración de histamina observándose un último pico de la concentración de este neurotransmisor en el día 5 postnatal (P5) , [7-9] y es después de la primera semana postnatal la concentración de histamina disminuye a los niveles que se encuentran en el adulto. Es importante mencionar que a partir del día E15 se pueden observar un gran número de fibras histaminérgicas en el hipotálamo, la corteza frontal y la corteza parietal. Además, los cuerpos celulares de las fibras de las neuronas histaminérgicas han sido detectadas en el SNC han sido detectadas entre los días E14 y E18 en el puente, atravesando la zona

tegmental ventral, dentro del cerebro medio y de manera prominente en el tracto óptico (Auvinen and Panula, 1988; Vanhala et al., 1994).

Por otro lado estudios de hibridación in situ han mostrado la expresión de los tres tipos de receptores a histamina reportados para el SNC [4, 10, 11]

A pesar de estas evidencias, no se había estudiado hasta el momento la importancia funcional de estos hallazgos, gracias a mi propuesta se cuanta en la actualidad con el primer estudio in vitro del papel que juega la histamina durante el desarrollo de la corteza cerebral, aumentando la proliferación celular debido a la activación del RH2 y aumentando la diferenciación neuronal debido a la activación del [12].

A pesar de todos estos datos y nuestra reciente aportación, el efecto de la histamina durante el desarrollo del SNC no es claro. El trabajo del laboratorio estará encaminado a estudiar el papel de esta amina durante el desarrollo del SNC, para lo cual se utilizaran técnicas farmacológicas in vivo (en animales hembras preñadas) e in vitro (cultivo celular), de manipulación de la actividad de receptores histaminérgicos, ensayos de unión, de hibridación in situ y/o de RT-PCR, de secuenciación, técnicas inmunocitoquímicas o inmunohistoquímicas, uso de RNA de interferencia, así como técnicas bioquímicas (por ejemplo, de detección de calcio intracelular utilizando el método de fura-2AM) para estudiar los mecanismos involucrados en los efectos de la HA durante el desarrollo. Hipótesis General La histamina esta involucrada en el programa temporal de proliferación y diferenciación neuronal de precursores neurales y durante el desarrollo embrionario del SNC, teniendo un papel importante en la formación adecuada de la arquitectura del sistema nervioso central para el buen funcionamiento del mismo. La obesidad, la desnutrición y la diabetes afectan el programa celular de proliferación y diferenciación adecuada, teniendo efectos sobre los niveles de HA cerebrales. Objetivo General Estudiar el papel in vitro e in vivo de la HA sobre el desarrollo de diversas áreas del SNC, con el propósito de entender la gran diversidad de funciones de esta amina a nivel del sistema nervioso central. Objetivos específicos iniciales 1.- Estudiar in vivo el efecto de la inhibición de la síntesis de HA por inyección peritoneal

de α-fluorometilhistamina y/o de la expresión de RHAérgicos usando RNAi durante el pico neurogénico sobre la proliferación, diferenciación y muerte celular.

2.- Estudiar los tipos de neuronas que se obtienen en los estudios in vitro. 3.- Estudiar los mecanismos por los cuales la HA promueve la proliferación, la

diferenciación neuronal y la muerte por apoptosis. 4.- Estudiar el efecto que tiene la HA sobre la expresión de factores y receptores que se

sabe están relacionados con la proliferación y la diferenciación neuronal in vivo e in vitro.

5.- Estudiar la relación de la HA con otros factores que se encuentran involucrados en la etapa neurogénica del desarrollo del SNC in vivo e in vitro.

6.- Estudiar in vivo e in vitro el efecto de la HA sobre la expresión de sus propios receptores.

7.- Estudiar los efectos de la desnutrición, la obesidad y la diabetes tipo sobre los efectos que hemos reportado de la HA y los objetivos 1-4, en cultivos provenientes de ratas preñadas a las que se les hayan inducido previamente estas condiciones fisiológicas experimentales o en cepas de ratas que las padezcan.

Bibliografía 1. Haas, H.L., O.A. Sergeeva, and O. Selbach, Histamine in the nervous system.

Physiol Rev, 2008. 88(3): p. 1183-241. 2. Nissinen, M.J. and P. Panula, Developmental patterns of histamine-like

immunoreactivity in the mouse. J Histochem Cytochem, 1995. 43(2): p. 211-27. 3. Nissinen, M.J., et al., Expression of histidine decarboxylase and cellular histamine-

like immunoreactivity in rat embryogenesis. J Histochem Cytochem, 1995. 43(12): p. 1241-52.

4. Drutel, G., et al., Identification of rat H3 receptor isoforms with different brain expression and signaling properties. Mol Pharmacol, 2001. 59(1): p. 1-8.

5. Panula, P., et al., Histamine-immunoreactive nerve fibers in the rat brain. Neuroscience, 1989. 28(3): p. 585-610.

6. Vanhala, A., A. Yamatodani, and P. Panula, Distribution of histamine-, 5-hydroxytryptamine-, and tyrosine hydroxylase-immunoreactive neurons and nerve fibers in developing rat brain. J Comp Neurol, 1994. 347(1): p. 101-14.

7. Pearce, L.A. and S.M. Schanberg, Histamine and spermidine content in brain during development. Science, 1969. 166(910): p. 1301-3.

8. Ferrer, I., et al., Histamine and mast cells in developing rat brain. J Neurochem, 1979. 32(2): p. 687-92.

9. Tuomisto, L. and P. Panula, Development of histaminregic neurons, in Histaminergic Neurons: Morphology and Function, T. Watanabe and H. Wada, Editors. 1991, Press, Boca Raton. p. 177-192.

10. Kinnunen, A., et al., In situ detection of H1-receptor mRNA and absence of apoptosis in the transient histamine system of the embryonic rat brain. J Comp Neurol, 1998. 394(1): p. 127-37.

11. Karlstedt, K., et al., Regional expression of the histamine H(2) receptor in adult and developing rat brain. Neuroscience, 2001. 102(1): p. 201-8.

12. Molina-Hernandez, A. and I. Velasco, Histamine induces neural stem cell proliferation and neuronal differentiation by activation of distinct histamine receptors. J Neurochem, 2008. 106(2): p. 706-17.

INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ

DIRECCIÓN DE INVESTIGACIÓN Insurgentes Sur 3877

Col. La Fama, C.P. 14269 Mexico, D.F., Tel. 55-28-80-36

www.innn.edu.mx

México D.F., 27 de Marzo de 2009. A quien corresponda, Por este medio me es muy grato recomendar la candidatura para el puesto de Profesora a la Dra. Anayansi Molina Hernández, a quien conozco hace 5 años, tiempo en el cual me ha permitido constar su gran capacidad académica, como lo refleja su CV y su capacidad de ser independiente debido a sus cualidades creativas e innovadoras, además de que la Dra. Molina presenta gran interés en la Docencia a nivel de posgrado y en un adecuado entrenamiento de los alumnos a su cargo. La Dra. Molina a lo largo de su trayectoria en el área de la investigación ha mostrado tener al capacidad para desarrollar investigación científica de alto nivel como lo hacen constar la publicaciones con las que cuenta hasta el momento, reflejado en su pertenencia al Sistema Nacional de Investigadores en el Nivel I. No tengo la más mínima duda de que la Dra. Molina logrará fortalecer el grupo de investigadores y enriquecerá el grupo académico al que ella pertenezca, prometiendo un desarrollo notable. Sin más por el momento, quedo de Uds., atentamente.

Abel Santamaría, Ph.D. Laboratorio de Aminoácidos Excitadores, Instituto Nacional de Neurología y Neurocirugía Manuel Velasco Suárez, S.S.A. Av. Insurgentes Sur 3877, México D.F. 14269 México Tel.: (+5255)5606-3822 (Ext. 2013) E-mail address: [email protected]


Sin más por el momento y aprovechando para enviarle un ... Molina... · Licenciatura en Nutrición...

Documents

Transcript of Sin más por el momento y aprovechando para enviarle un ... Molina... · Licenciatura en Nutrición...