Incidencia y factores asociados de Helicobacter pylori en lapoblación infantil del departamento de Cajamarca - Perú’

Item Type info:eu-repo/semantics/bachelorThesis

Authors Calderón Rivera, Andrea Ximena; Espinal Reyes, Maria DeFátima; Palacios Cuervo, Fernando André

Publisher Universidad Peruana de Ciencias Aplicadas (UPC)

Rights info:eu-repo/semantics/openAccess

Download date 27/06/2022 20:30:05

Item License http://creativecommons.org/licenses/by-nc-nd/4.0/

Link to Item http://hdl.handle.net/10757/621826

FACULTAD DE CIENCIAS DE LA SALUD

ESCUELA DE MEDICINA

‘’Incidencia y factores asociados de Helicobacter pylori en la población infantil

del departamento de Cajamarca - Perú’’

Proyecto de Investigación

Para optar el título profesional de:

MEDICO CIRUJANO

AUTORES:

CALDERÓN RIVERA, ANDREA XIMENA

ESPINAL REYES, MARIA DE FÁTIMA

PALACIOS CUERVO, FERNANDO ANDRÉ

ASESORES:

Ph.D. JUANA DEL VALLE

Ph D. ALONSO SOTO

CALIFICACIÓN: APROBADO

FECHA DE SUSTENTACION 12 DE FEBRERO DEL 2016

LIMA – PERÚ 2016

2

3

DEDICATORIA

Gracias a dios por permitirnos vencer cada obstáculo puesto en este largo viaje

Gracias a nuestros padres, familiares, amigos y asesores

por confiar y retarnos en esta aventura.

4

AGRADECIMIENTOS

A nuestros maestros, amigos y padres

por todo el apoyo brindado, por que sin ellos

todo este esfuerzo no hubiera sido tan gratificante.

5

Tabla de Contenido

Pag.

1. Artículo Científico Publicado 6

1.1. Resumen 8

1.2. Introducción 9

1.3. Materiales y Métodos 11

1.4. Resultados 13

1.5. Discusión 14

1.6. Conclusión 16

1.7. Bibliografía 17

1.8. Anexos 25

1.8.1. Tablas 25

1.8.2. Flujograma 30

1.8.3. Carta de Comité de Ética 31

1.8.4. Consentimiento informado 32

2. Revista de Publicación Científica 34

3. Proceso de Revisión 37

3.1. Envío original de artículo

4. Estado de Publicación 39

6

1.0 Artículo Científico

7

FULL TITLE:

Prevalence and associated factors to Helicobacter pylori infection in children from a

community of Cajamarca-Peru

AUTHORS:

Fatima Espinal-Reyes1; Andrea Calderón-Rivera

1; Fernando Palacios-Cuervo

1; Carlos

Palomares-Reyes2,3

; Fernando Vásquez-Achaya,2,3

; Jorge Bazán-Mayra4, Gabriela Ulloa-

Urizar2,3

; Alonso Soto1; Miguel Angel Aguilar-Luis

1,2,3; Juana del Valle Mendoza

1,2,3

AFFILIATIONS:

1Medicine School, Health Sciences Faculty, Universidad Peruana de Ciencias Aplicadas - UPC.

Av. San Marcos cdra. 2. Cedros de Villa. Lima, Perú.

2 Investigation Center of the Health Sciences Faculty, Universidad Peruana de Ciencias

Aplicadas (UPC), Av. San Marcos cdra 2 Cedros de Villa, Lima, Peru.

3 Molecular Biology Laboratory, Instituto de Investigación Nutricional. Av. La Molina 1885.

Lima 12, Perú.

4Dirección Regional de Salud de Cajamarca (DIRESA-Cajamarca), Cajamarca, Perú.

Corresponding author

Juana del Valle

Universidad Peruana de Ciencias Aplicadas

Av San Marcos Cdra 2, Chorrillos, Lima-Peru

E-mail: jdelvall@upc.edu.pe

Phone. +51 1988040532

Fax. +51 1 3496023

Miguel Angel Aguilar-Luis

Universidad Peruana de Ciencias Aplicadas

Av San Marcos Cdra 2, Chorrillos, Lima-Peru

E-mail: pcmemagui@upc.edu.pe

Phone. +51 1985032252

Fax. +51 1 3496023

8

ABSTRACT

Background: The prevalence of H. pylori is greater than 50% in low development countries. In

children, infection with H. pylori produces effects such as low height, impairment in growth

especially in pubertal age. Polymerase Chain Reaction has a high sensitivity and specificity of

89.6% and 100% respectively, compared to other invasive methods. The objective of this study

is to determine the frequency of patients with presence of H. pylori in asymptomatic children in a

rural community in the north of Peru, using PCR technique in stool samples.

Methods: A cross-sectional study with a convenience sampling was performed, resulting in 147

children aged between 6-14 years old of the district of San Pablo in Cajamarca, Peru. Using stool

samples H. pylori DNA was obtained, then PCR amplification was done, and sequencing those

with positive results, in an agreement with Macrogen, Seoul - Korea.

Results: It was found a frequency of H. pylori positive cases of 21.1% with a CI 95% of 14.8 to

28.6. It was found a frequency (p=0.01) of positive for H. pylori among males (29% IC95: 19.1-

40.5) compared to women (12.7%; IC95: 6.0-22.7). There was no statistically significant

differences between those positive and negative patients with H. pylori compared to age (p =

0.57), presence of overweight (p = 0.09), or excreta disposal (p = 0.71). It was not found

significance difference among other variables.

Conclusion: Our study found a high frequency of H. pylori determined by a molecular test with

high sensitivity and specificity, demonstrating the feasibility of its implementation in rural

communities. It can be considered as a tool for surveillance in areas of high prevalence of H.

pylori infection.

Keywords: Helicobacter pylori, PCR, gastric disease, duodenal peptide ulcer disease

9

INTRODUCTION

Helicobacter pylori is the main cause of gastric and duodenal peptide ulcer disease; as well as

the most important factor associated to chronic gastritis (1). Worldwide, the estimated prevalence

of H. pylori is greater than 50% in the population (2-5), with a higher number of cases observed

in under developed countries (5,7). Moreover, individuals infected with H. pylori have an

increased risk of gastric adenocarcinoma and mucosa associated lymphoid tissue (MALT)

lymphoma (4, 5, 8-10). In children, H. pylori infections are also linked to low height, failure to

thrive and growth retardation especially during puberty (6). Therefore, an early detection and

treatment of the bacteria is essential to avoid chronic disease and further complications; since the

World Health Organization (WHO) considers the H. pylori infections as group 1 carcinogens (7,

10, 11).

In Latin America, the H. pylori is recognized as a major public health problem, with endemic

areas that can reach a prevalence of 80% of the adult population (12). This increase number of

cases has been linked to numerous factors including: low income, malnutrition, poor hygiene,

among others (6). All these risk factors facilitate an early exposure to the bacteria and

asymptomatic infection.

Both invasive and non-invasive methods have been described for the H. pylori detection (13).

Invasive tests require an endoscopic sample and include: histologic analysis, urease test and

cultures. On the other hand, the urea breath test, serologic tests and the antigen detection in feces

are non-invasive methods with limited applications (14). In that sense, a positive serologic result

cannot differentiate between a current and a past infection (15); and the urea breath test requires

very sophisticated equipment for spectrophotometry analysis, which is not always available in

the low-income settings (16). A stool sample can be very convenient for H. pylori detection,

especially in children, due to their easy and fast sample collection; and a few methods are used

for this bacterial detection: cultures, polymerase chain reaction (PCR) and enzymatic

immunoassays (17). However, a very wide range of detection rates have been reported with these

methods, due to the fast degradation of the bacteria in the gastrointestinal tract which leads to a

very low concentration of the H. pylori in the feces (18,19).

10

In the last few decades, non-invasive test have been gaining more importance, for the early

detection of H. pylori, especially in the after-treatment infants population (18). In addition, PCR

has shown a high sensitivity and specificity of 89.6% and 100% respectively, in comparison with

other invasive methods (20). The H. pylori eradication can drastically reduce both gastric and

duodenal ulcers rates in children, as well as prevent further complications. Therefore, a specific

and fast diagnostic method is crucial (21).

The main objective of this study is to determine the frequency of children infected with H. pylori

in a rural community in the north of Peru, by PCR detection in stool samples, as well as to

identify the most important associated factors to this infection in children population.

11

MATERIALS AND METHODS

Patients and ethics

A cross-sectional study was conducted in 147 children between 6 to 14 years old from the district

of San Pablo in Cajamarca-Peru. Informed consent was obtained from the children before

samples collection. The protocol of the study was approved by the Ethics committee of the

“Hospital Regional de Cajamarca-Peru”.

Samples preparation

The sample was obtained from each participant and all of them were transported to the molecular

biology laboratory of the Universidad Peruana de Ciencias Aplicadas (UPC), careful under cold

chain. Upon arrival, three aliquots of 200 µl each were prepared from each patient sample, and

stored at -70 °C until processing.

DNA extraction

Extracted DNA was from a volume of 200 µl of each aliquot using a commercial kit (High Pure

Template Preparation Kit, Roche Applied Science, Germany) (24) according to the manufacturer

instructions. DNA extraction was subjected to a dilution of 100 µl nuclease free buffer, assayed

immediately or stored at -70°C until use.

PCR amplification for detection H. pylori

PCR was target to the 23S rRNA region for H. pylori detection in feces samples. The primers,

forward primers (FP-1) and reverse primers (RP-1) previously designed and verified, were

synthesized for the amplification of a 320 bp fragment from the 23S rRNA (25,26) (Table 1). For

the amplification of the genomic DNA, a 20 µl mix was prepared, containing 10 µl of Ready

Mix Enzyme Solution (Taq polymerase, 2.5 mM MgCl2; 15 mM Tris/HCl PH 8.3, 50 mM KCl,

200 mM each deoxynucleotide) (KAPA Taq ReadyMix PCR Kit, Kappa Biosystems,

Massachusetts, United States), 20 pmol of each primer (Macrogen, Seoul, Korea), free water and

8µl of DNA; using a thermocycler Verity (Applied Biosystems, Foster City, CA, USA). The

amplified products were analyzed, recovered and sequence as mentioned above to confirm the

PCR results. All samples were compared to a positive control, and also they had a base pair

12

marker control. The adaptation of the thermocycler conditions for this process is presented in the

graph.

The presence and size of the amplified product is analyzed by electrophoresis on 2.5% agarose

gel (FMC, Rockland, ME) which was previously dyed with 3 µg / ml ethidium bromide and

separated in 1x Tris buffer - acetic EDTA. The bands were using a KODAK 1500 LOGIC

(Eastman Kodak Company, Rochester, NY, USA) Documenting system. To confirm the

specificity of the amplicons, all positive samples were sequenced in the service of Macrogen -

Korea, to verify the results.

Statistical analysis

The data obtained through questionnaires provided by DIRESA were entered into a database of

Microsoft Excel 2012, and coded according to the categories belonging to each variable. The

variable Body Mass Index (BMI) was categorized by percentiles established by WHO (27, 28).

Categorical variables, expressed as absolute frequencies and percentages. Numeral variables

expressed as median and interquartile range. A secondary analysis was performed to explore the

association of possible predictors. P-values <0.05 were considered to denote statistical

significance.

To assess association between categorical variables, we used Chi squared test or Fisher exact

test, and for nonparametric variables Wilcoxon test was used. The analysis was performed using

the statistical package STATA v11.

13

RESULTS

The prevalence of H. pylori was 21.1% (31/147) (Table 2). Demographic characteristic in the

147 children are summarized in table 2. The male to female proportion was 76:71 with an

average age of 9 years old, with an interquartile range (IQR) of 4 years, corresponding 76

(51.7%) male participants (Table 3). The children age was not associated with the H. pylori

prevalence. However, a significant association was observed between male gender and positives

cases of H. pylori with 70.9% (22/31, 2=5.84, p=0.01).

The BMI did not show any association with the prevalence of the H. pylori. A higher positives

cases of H. pylori was observed in the group of children with normal weight (80.6%, 25/31),

while 11.6% was found in overweight (percentile p > 85).

Furthermore, an association between the use of latrines and a higher rate of positives cases was

observed (2=4.08, p=0.043), with a prevalence of 80.6% (25/31). On the contrary, children who

had access to a drain system presented fewer infections in 19.3% (6/31).

On table 4, the frequency of positive samples for H. pylori is compared to the dietary

characteristics; and none of them were associated to a higher rate of cases. However, consuming

raw lettuce and having domestic animals showed a prevalence of 90.32% (28/31) and 77.42%

(24/31), respectively (Table 4).

Seven clinic symptoms were constantly observed in children with H. pylori detected including

headache, fever, nauseas, vomits, diarrhea, loss of weight and abdominal pain in the last 3

months (Table 5).

14

DISCUSSION

In recent years, emphasis has been placed on the use of non-invasive diagnostic methods for the

detection of H. pylori in pediatric population (29, 30); however, their use is not yet standardized

in routine clinical practice. Among the most promising techniques is set the PCR, however, so

far there have not been studies at the national level to assess the feasibility and utility of it use.

The PCR technique used in this study to find the frequency of H. pylori have proven an

advantage in the detection of bacteria, especially pathogens difficult to culture in vitro (31). This

method can detect molecular pathogen regardless of its properties bacterial viability with high

sensitivity and specificity of 95% (31). These benefits of PCR have been described in several

studies, for example Montealegre et al; they reported a prevalence of H. pylori in 78.3% with

histological diagnosis and 68.3% for detection by PCR (32). Another study by Gonzales et al;

they compared the detection of H. pylori antigen in feces with ELISA against other invasive

methods, demonstrating the presence of the antigen with a 90% sensitivity and 100% specificity;

and a positive predictive value of 100% (33). Another study by Smith et al; they compared the

detection of H. pylori in dyspeptic patients by urease breath test and stool PCR, which showed

the presence of H. pylori by PCR in 20.6% (34).

Our study demonstrates the feasibility of using the PCR as a method to detect the genome of H.

pylori in stool samples, in children in a rural area. We found a prevalence of 21.1%. We did not

find in the literature previous studies that used PCR to detect H. pylori, however, studies have

assessed the frequency of H. pylori antigen in stool samples in 18.9% (35).

They have also performed serological studies in Brazil at a rate of 35.6% (36); in Taiwan with

15.1% (37). In Peru, there are not studies evaluating the frequency of H. pylori by noninvasive

tests in pediatric population. Peruvian literature has only evaluated the presence of H. pylori in

histopathologic specimens. A study in the Cayetano Heredia Hospital between the periods 2003

to 2006, found a prevalence of 46% in gastric biopsies (38).

15

Our study showed a higher frequency of H. pylori positivity in males (29% vs. 12.7%). The

literature shows discordant evidence about a study by Kate et al; demonstrating an association

with male gender and the frequency of H. pylori (57%) (39). By another hand; other studies such

as De Martel and Parsonnet and Çınar et al; they found no significant difference between gender

and H. pylori (40, 41).

There are other factors associated with the presence of H. pylori, including age (41, 42), BMI

(43), level of sanitation (44), and dietary consumption. Regarding the relationship between H.

pylori infections and nutritional status, we found that the nutritional status of a population with

greater than 85 percentiles were infected in 54.5% compared to 23.8% of the population with

adequate percentile for age (p10-p85 as WHO tables). Some studies suggest that H. pylori

colonization may be associated with growth retardation, by compromising the acid barrier of the

stomach, reducing the defenses against pathogens, and predisposing the host to diarrheal

diseases, resulting in mal-absorption of some nutrients (45-47). However, in our study there was

no significant difference related to growth percentile for height, but further investigations with a

larger population are required. Our study found no association with any of these factors.

Although, it must be emphasized the exploratory nature of our analysis which probably does not

have enough power to detect these associations. It is important to generate larger studies to

formally evaluate the possible factors associated with H. pylori infections, considering that our

country has a high prevalence of this infection and its complications including gastric cancer in

adults (21.2 cases per 100 000 inhabitants) (47).

The study presented in their main limitations, the population belonging to the district of San

Pablo which represents 1.7% of Cajamarca population (48), the smallest of the department; as

well as belonging to a poverty area, so those results cannot be extrapolated to other regions. We

believe it is an event unlikely because of the staff was previously trained.

16

CONCLUSION

Our study found a high frequency of H. pylori in a specific population with a molecular test with

high sensitivity and specificity, demonstrating the feasibility of its implementation in rural

communities. This test can be considered as a tool for surveillance in areas of high frequency of

infection for H. pylori.

ACKNOWLEDGMENTS

Grant-UPC-501-2016. JDVM support was provided by 5to

Incentives for Research of the

Peruvian University of Applied Sciences (UPC). Lima-Peru.

AUTHORS CONTRIBUTIONS

JdVM, CPR. FVA, and FP performed the PCR for H. pylori; JdVM and MAAL designed the

study protocol and they are responsible for obtaining funding and laboratory work supervision.

FPC, ACR, FER, GUU was responsible for the clinical assessment, samples collection and

database completion. FP, ACR, FE, JdVM, MAAL drafted the manuscript. All authors critically

revised the manuscript for intellectual content. All authors read and approved the final

manuscript.

CONFLICT OF INTERESTS

On behalf of all authors, the corresponding author states that there are no conflicts of interest or

funding related to this study.

17

REFERENCES

1. Axon A. Helicobacter pylori and public health. Helicobacter. 2014 (1): 68-73.

[Consultado:11/Enero/2016] Available from: http://www.ncbi.nlm.nih.gov/pubmed/25167948

2. Malfertheiner P, Megraud F, O'Morain CA, et al. Management of Helicobacter pylori

infection--the Maastricht IV/ Florence Consensus Report. Gut. 2012 (61): 646-64.

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/?term=Management+of+Helicobacter+pylori+infection

%E2%80%94the+Maastricht+IV%2F+Florence+Consensus+Report

3. Hunt R; Xiao S; Megraud F et al. Helicobacter pylori en los países en desarrollo. Guías

prácticas de la Organización Mundial de Gastroenterología. (2010)

[Consultado:11/Enero/2016] Available from:

http://www.worldgastroenterology.org/UserFiles/file/guidelines/helicobacter-pylori-spanish-

2010.pdf

4. Ruiz R, Huanca A. Prevalencia de infección por H. pylori en una población de nivel

socioeconómico medio y alto. Rev. Méd. La Paz 2013 19 (1). [Consultado: 11/Enero/2016]

Available from: http://www.scielo.org.bo/scielo.php?script=sci_arttext&pid=S1726-

89582013000100006

5. Alvarado C, Venegas D. Sobrevida de pacientes con cáncer gástrico en el Perú, 2009–2010.

Rev Panam Salud Pública. 2015 (37): 133–9. [Consultado:11/Enero/2016] Available from:

http://www.scielosp.org/pdf/rpsp/v37n3/v37n3a02.pdf

6. Leandro S, Hernández M, Torroba L, et al. Infección por Helicobacter pylori en población

infantil: prevalencia, factores asociados e influencia sobre el crecimiento. An Pediatr (Barc)

2005 (63): 489-94. [Consultado:11/Enero/2016] Available from:

http://www.analesdepediatria.org/index.php?p=watermark&idApp=UINPBA00005H&piiItem

=S1695403305702472&origen=analesdepediatria&web=analesdepediatria&urlApp=http://w

ww.analesdepediatria.org&estadoItem=S300&idiomaItem=es

18

7. Mendoza D, Herrera P, Gilman R, et al. Variation in the prevalence of gastric cancer in Peru.

Int. J. Cancer 2008 (123): 414-20. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/18449884

8. Peleteiro B, Bastos A, Ferro A, et al. Prevalence of Helicobacter pylori infection worldwide: a

systematic review of studies with national coverage. Dig Dis Sci. 2014 (59): 1698-709.

[Consultado:11/Enero/2016] Available from: http://www.ncbi.nlm.nih.gov/pubmed/24563236

9. McColl K. Helicobacter pylori Infection. N Engl J Med 2010 (362): 1597-604.

[Consultado:11/Enero/2016] Available from:

http://www.nejm.org/doi/pdf/10.1056/NEJMcp1001110

10. Ramírez A, Sánchez R. Helicobacter pylori y cáncer gástrico. Rev. Gastroenterol – Perú

2008: (28). [Consultado: 11/Enero/2016] Available from:

http://www.scielo.org.pe/scielo.php?script=sci_arttext&pid=S1022-51292008000300008

11. Soltani J; Nikkhoo B; Khormehr J et al. Breastfeeding and Helicobacter pylori Infection in

Early Childhood: a Continuing Dilemma. Iranian Journal of Pediatrics. 2014 (24): 745-752.

[Consultado:11/Enero/2016] Disponible en:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4442837/

12. Fuentes E; Camorlinga M; Maldonado C. Infección, inflamación y cáncer gástrico. Salud

pública de México. 2009; 51: 427-433. Disponible en:

http://bvs.insp.mx/rsp/articulos/articulo.php?id=002379

13. Lopes A, Vale F, Oleastro M. Helicobacter pylori infection - recent developments in

diagnosis. World J Gastroenterol. 2014 (20): 9299–9313. [Consultado:11/Enero/2016]

Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4110561/

19

14. Okuda M, Osaki T, Kikuchi S, et al. Evaluation of a stool antigen test using a mAb for native

catalase for diagnosis of Helicobacter pylori infection in children and adults. J Med

Microbiol. 2014 (63): 1621-1625. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/?term=Evaluation+of+a+stool+antigen+test+using+a+

mAb+for+native+catalase+for+diagnosis+of+Helicobacter+pylori+infection+in+children+an

d+adults

15. Yao-Kuang W, Fu-Chen K, Chung-Jung L, et al. Diagnosis of Helicobacter pylori infection:

Current options and developments. World J Gastroenterol. 2015 (21): 11221–11235.

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4616200/

16. Sreekumar J, France N, Taylor S, et al. Diagnosis of Helicobacter pylori by carbon-13 urea

breath test using a portable mass spectrometer. SAGE Open Med. 2015 (3).

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/?term=Diagnosis+of+Helicobacter+pylori+by+carbon-

13+urea+breath+test+using+a+portable+mass+spectrometer

17. Kabir S. Detection of Helicobacter pylori in faeces by culture, PCR, and enzyme

immunoassay. J Med. Microbiol. 2001 (50): 1021-1029. [Consultado:11/Enero/2016]

Available from:

http://www.microbiologyresearch.org/docserver/fulltext/jmm/50/12/mjm5012.1021.pdf?expir

es=1444714494&id=id&accname=guest&checksum=88A7A9D7B260800458A97D1794316

9FD

18. Leal Y, Cedillo-Rivera R, Simón J, et al. Utility of stool sample-based tests for the diagnosis

of Helicobacter pylori infection in children. J Pediatr Gastroenterol Nutr. 2011 (52): 718-28.

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/?term=Utility+of+Stool+Sample%E2%80%93based+T

ests+for+the+Diagnosis+of+Helicobacter+pylori+Infection+in+Children

20

19. Attallah A, Ismail H, Ibrahim G, et al. Use of a Novel Enzyme Immunoassay Based on

Detection of Circulating Antigen in Serum for Diagnosis of Helicobacter pylori Infection.

Clinical and Diagnostic Laboratory Immunology, 2004: 775–779.

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC440618/pdf/0168-03.pdf

20. Makristathis A, Barousch W, Pasching E, et al. Two Enzyme Immunoassays and PCR for

Detection of Helicobacter pylori in Stool Specimens from Pediatric Patients before and after

Eradication Therapy. Journal of Clinical Microbiology. 2000: 3710–3714.

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC87461/pdf/jm003710.pdf

21. Ou Z, Xiong L, Li D, et al. Evaluation of a new fluorescence quantitative PCR test for

diagnosing Helicobacter pylori infection in children. BMC Gastroenterology 2013 (13) : 7.

[Consultado:11/Enero/2016] Available from:

http://www.biomedcentral.com/content/pdf/1471-230X-13-7.pdf

22. Instituto Nacional de Salud. Compendio de Normativa Ética para uso por los Comités de Ética

en Investigación. Ministerio Nacional del Perú. 2011. [Consultado:11/Enero/2016] Disponible

en:

http://www.ins.gob.pe/insvirtual/images/otrpubs/pdf/COMPENDIO%20DE%20ETICA(3.2.2

012).pdf

23. Instituto Nacional de Salud. Guía Nacional para la Constitución y Funcionamiento de los

comités de ética en investigación en el Perú. Ministerio Nacional del Perú. 2012.

[Consultado:11/Enero/2016] Disponible en:

http://www.ins.gob.pe/insvirtual/images/otrpubs/pdf/Guia%20Comit%C3%A9s%20de%20eti

ca.pdf

21

24. Qiagen. QIAamp DNA Stooal Handbook. Biolabs. New England. Second Edition. 2012: 1-44.

[Consultado:11/Enero/2016] Available from: www. QIAamp-DNA-Stool-Handbook---June-

2012-EN.pd

25. Tomb J, White O, Kerlavage A et al. The complete genome sequence of the gastric pathogen

Helicobacter pylori. Nature: Internacional weekly journal of science. 1997 (388): 539-547.

Available from: http://www.nature.com/nature/journal/v388/n6642/full/388539a0.html#B16

26. Furuta T1, Soya Y, Sugimoto M, et al. Modified allele-specific primer-polymerase chain

reaction method for analysis of susceptibility of Helicobacter pylori strains to clarithromycin.

J Gastroenterol Hepatol. 2007 (22): 1810-5. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/?term=Modified+allele-specific+primer-

polymerase+chain+reaction+method+for+analysis+of+susceptibility+of+Helicobacter+pylori

+strains+to+clarithromycin.

27. CDC. Percentiles del Índice de Masa Corporal por edad: Niños. 2000. Centro Nacional de

Estadísticas de Salud en colaboración con el Centro Nacional para la Prevención de

Enfermedades Crónicas y Promoción. [Consultado: 21/Dic/2016]. Available from:

http://www.cdc.gov/growthcharts/data/spanishpdf95/co06l023.pdf

28. CDC. Percentiles del Índice de Masa Corporal por edad: Niñas 2000. Centro Nacional de

Estadísticas de Salud en colaboración con el Centro Nacional para la Prevención de

Enfermedades Crónicas y Promoción. [Consultado: 21/Dic/2016]. Available from:

http://www.cdc.gov/growthcharts/data/spanishpdf95/co06l024.pdf

29. Konstantopoulos N, Russmann H, Tash C et al. Evaluation of the Helicobacter pylori stool

antigen test (HpSA) for detection of Helicobacter pylori infection in children. Am J

Gastroenterol. 2001 (96): 677-683. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/11280533

22

30. Seeichi Kato, Ozawa M, Okuda M et al. Accuracy of the Stool Antigen Test for the Diagnosis

of Childhood Helicobacter pylori Infection: A multicenter Japanese Study. The American

Journal of Gastroenterlogy. 2003. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/12591044

31. Premoli G, González A, Millán B, et al. Diagnóstico de Helicobacter pylori mediante la

reacción en cadena de la polimerasa. Rev Cubana Med Trop n.2 Ciudad de la Habana Mayo-

Ago. 2004. [Consultado:11/Enero/2016] Available from:

http://scielo.sld.cu/scielo.php?pid=S0375-07602004000200001&script=sci_arttext

32. Montealegre MC, Jaramillo C, Montealegre G, et al. Detección histológica y molecular de

Helicobacter pylori y genotipificación con base en los genes de virulencia babA2 e iceA en

pacientes con patología gástrica benigna. Rev Chil Infect 2010, 112 - 118.

[Consultado:11/Enero/2016] Available from: http://www.scielo.cl/pdf/rci/v27n2/art02.pdf

33. González C, Serrano C, Harris P. Diagnóstico de la infección poe Helicobacter pylori en niños

mediante la detección de antígenos en deposiciones. Rev Méd Chile 2007; 135: 182-188.

Available from: http://www.scielo.cl/scielo.php?script=sci_arttext&pid=S0034-

98872007000200006

34. Smith S, Fowora M, Lesi O, et al. Application of stool-PCR for the diagnosis of Helicobacter

pylori from stool in Nigeria- a pilot study. Springerplus. 2012; 1: 78. Available from:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3568462/

35. Zehra T, Dilek Y, Erhun K. Diagnostic value of stool antigen and antibody tests for

Helicobacter pylori infection in Turkish children with upper gastrointestinal complaints

before and after eradication. The Turkish Journal of Pediatrics 2010 (52): 505 - 511

[Consultado 11/02/2016] Available from:

http://www.turkishjournalpediatrics.org/pediatrics/pdf/pdf_TJP_824.pdf

23

36. Miranda A, Machado R, Silva E et all. Seroprevalence of Helicobacter pylori infection among

children of low socioeconomic level in São Paulo. Sao Paulo Med. 2010 (128): 187-191.

[Consultado: 11/02/2016] Avaible from: http://dx.doi.org/10.1590/S1516-

31802010000400002

37. Ding-Bang L, Jye-Bin L, Chien-Yi C et all. Seroprevalence of Helicobacter pylori infection

Among Schoolchildren and Teachers in Taiwan 2007 (12):258-264 [Consusltado:

11/02/2016].

38. Muñoz A, Cok J, Bussalleu A, et al. Helicobacter pylori en niños atendidos en el Hospital

Nacional Cayetano Heredia durante los años 2003 al 2006. Rev Gastroenterol Perú. 2008

(28): 109-118. [Consultado:11/Enero/2016] Disponible en:

http://www.scielo.org.pe/pdf/rgp/v28n2/a02v28n2.pdf

39. Kate V, Ananthakrishnan N, Ratnakar C, et al. Anti - H. pylori IgG seroprevalence rates in

asymptomatic children and adults from South India. Indian J Med Microbiol. 2001 (19): 20 -

5. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pubmed/17664801

40. De Martel C, Parsonnet J. Helicobacter pylori infection and gender: a meta-analysis of

population-based prevalence surveys. Dig Dis Sci. 2006 (51): 2292 - 301.

[Consultado:11/Enero/2016] Available from: http://www.ncbi.nlm.nih.gov/pubmed/17089189

41. Razavi A, Bagheri N, Azadegan-Dehkordi F, et al. Comparative Immune Response in

Children and Adults with H. pylori Infection. J Immunol Res. 2015: 315957.

[Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4606101/

42. Rajindrajith S, Devanarayana N, Janaka H. Helicobacter Pylori Infection in Children. Saudi J

Gastroenterol. 2009 15(2): 86–94. [Consultado:11/Enero/2016] Available from:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2702974/

24

43. Lender N, Talley N, Enck P et all. Review article: associations between Helicobacter pylori

and obesity – an ecoligical study. Aliment Pharmacol Ther 2014 (40)24-31. [Consultado:

11/02/2016]

44. Ministerio de Salud-Dirección de Epidemiología. Análisis de la situación del cáncer. 2013:

30-31. [Consultado: 11/02/2015] Available from:

http://www.dge.gob.pe/portal/docs/asis_cancer.pdf.

45. Páez M, Barón M, Solano L, et al. Infección por Helicobacter pylori (13C-UBT) y factores

nutricionales y socioeconómicos asociados en escolares de estratos bajos de la ciudad de

Valencia. Venezuela. ALAN vol.56 no.4 Caracas Dec 2006. Available from:

http://www.scielo.org.ve/scielo.php?script=sci_arttext&pid=S0004-

06222006000400005&lng=en&nrm=iso&ignore=.html

46. Sullivan P, Thomas JE, Wight D, et al. Helicobacter pylori in Gambian children with chronic

diarrhoea and malnutrition. Arch Dis Child 1990 Feb; 65:189-91. Available from:

http://www.ncbi.nlm.nih.gov/pubmed/2317065

47. Dale A, Thomas J, Darboe M, et al. Helicobacter pylori infection, gastric acid secretion, and

infant growth. J Pediatr Gastroenterol Nutr. 1998 Apr; 26: 393-7. Available from:

http://www.ncbi.nlm.nih.gov/pubmed/9552134.

48. Ministerio de Salud- Instituto Nacional de Enfermedades Neoplásicas. Guía de práctica

clínica cáncer Gástrico. 2011. [Consultado: 11/02/2015] Avaiable from:

http://bvs.minsa.gob.pe/local/minsa/1698.pdf (Ministerio de Salud-Dirección de

Epidemiología. Análisis de la situación del cáncer. 2013: 30-31. [Consultado: 11/02/2015]

Available from: http://www.dge.gob.pe/portal/docs/asis_cancer.pdf.

49. Banco central de reserva del Perú. Informe Económico y Social Región Cajamarca. 2007.

[Consultado:11/Enero/2016] Available from: http://www.bcrp.gob.pe/docs/Proyeccion-

25

Institucional/Encuentros-Regionales/2007/Cajamarca/Informe-Economico-Social/IES-

Cajamarca.pdf

ANEXOS:

TABLES

Table 1. Oligonucleotide sequence

Primer Sequence (5´3´) Target

FP-1 TCGAAGGTTAAGAGGATGCGTCAGTC 23S rRNA

RP-1 GACTCCATAAGAGCCAAAGCCCTTAC

26

Table 2. Prevalence of H. pylori by PCR in children of school age in a district of San Pablo

in Cajamarca-Peru 2015.

Identified of H. pylori

by PCR

Cases Frequency

(n)

Prevalence

(%)

Positives 31 21.1

Negatives 116 78.9

Total 147 100.0

27

Table 3. Demographics characteristics in children from a district of San Pablo in Cajamarca-

Peru 2015.

CHARACTERISTICS Total of cases

n=147 (%)

Positives for

H. pylori by

PCR

n=31 (%)

Negatives for

H. pylori by

PCR

n=116 (%)

P value*

Age a 9 (4) 8 (3) 9 (4)

Gender* 0.01

Masculine 76 (51.7) 22 (70.9) 54 (46.5)

Feminine 71 (48.3) 9 (29.0) 62 (53.4)

BMI (kg/m2)* 0.12

Normal (p10-p85) 130 (88.4) 25 (19.2) 105 (80.8)

Overweight (p85- p95) 17 (11.5) 6 (35.3) 11 (64.7)

Drain system at

home* 0.71

Bathroom 51 (34.6) 6 (19.3) 45 (31.0)

Latrine 96 (65.3) 25 (80.6) 71 (68.9)

a: Median and Interquartile range

* Chi-Square of Pearson (2), p<0.05

28

Table 4. Dietary characteristics in children infected with Helicobacter pylori in a district of

San Pablo-Cajamarca, 2015.

ASSOCIATED FACTORS

Positives for H.

pylori

n=31 (%)

Negatives for H.

pylori

n=116 (%)

p-value*

Unboiled water consumption** 4 (12.9) 18 (15.5) 1.00

Boiled water consumption** 4 (12.9) 28 (24.1) 0.17

Washing hands before eating* 31 (100.0) 115 (99.1) 1.00

Washing hands after eating* 31 (100.0) 114 (98.2) 1.00

Domestic animal raising* 24(77.4) 76(65.5) 0.20

Chewing grass** 4 (12.9) 13 (11.2) 1.00

Raw lettuce consumption* 28 (90.3) 112 (96.5) 0.16

Watercress consumption* 12 (38.7) 34 (29.3) 0.31

Meat consumption* 31 (100.0) 115 (99.1) 1.00

Legume consumption* 14 (45.1) 61 (52.5) 0.46

Tubers consumption* 7 (22.5) 40 (34.4) 0.20

Fruits consumption* 12 (38.7) 46 (39.6) 0.92

Vegetables consumption* 16 (51.6) 60 (51.7) 0.99

Egg consumption* 17 (54.8) 79 (68.1) 0.16

Milk consumption* 20 (64.5) 76 (65.5) 1.00

Emollient consumption* 12 (38.7) 35 (30.1) 0.36

* Chi-Square of Pearson (2)

** Fisher’s exact test

29

Table 5. Clinical symptoms in children infected with Helicobacter pylori in a district of San

Pablo-Cajamarca, 2015.

CLINICAL SYMPTOMS

Positives for H.

pylori

n=31 (%)

Negatives for H.

pylori

n=116 (%)

p-value*

Diarrhea in the last 3 months* 6 (19.4) 29 (25.0) 0.51

Weight loss in the last 3 months* 15 (48.4) 58 (50.0) 0.87

Abdominal pain in the last 3

months*

20 (64.5) 87 (75.0) 0.24

Nauseas** 2 (6.5) 9 (7.8) 1.00

Vomiting** 2 (6.5) 11 (9.5) 0.73

Fever** 3 (9.7) 9 (7.8) 0.71

Headache** 4 (12.9) 7 (6.0) 0.24

* Chi-Square of Pearson (2)

** Fisher’s exact test

30

Flujograma de la población

31

Carta de autorización del Comité de Ética

32

Documento de Consentimiento Informado y Asentimiento:

33

34

2.0 Revista de Publicación Científica

35

BMC Research Notes

36

‘’BMC Research Notes’’ es una renombrada revista internacional de la BioMed Central

evocada a la publicación de investigaciones científicas originales, con mayor incidencia en temas

relacionados a la medicina. Es una revista de acceso libre con publicación virtual de sus

artículos. Está indexada en múltiples bases de datos, tales como PubMed, MEDLINE, Scopus,

Embase, Citebase, entre otras.

BMC Research Notes está considerada como una de las revistas médicas de alto

impacto científico, ya que pertenece al segundo cuartil (Q2) dentro de la clasificación de revistas

científicas dedicadas al tema. El factor de impacto (Impact Factor IF) de BMC Research Notes

fue de 2.6.

37

3.0 Proceso de Revisión

38

39

4.0 Estado de Publicación

40

Estado de Publicación

Desde el 04 de Enero del 2016, el artículo se encuentra en proceso de revisión por parte de la

revista. Nos comprometemos a corregir las observaciones planteadas por la revista y, en caso sea

rechazado, a enviar el artículo a otra revista indizada en SCOPUS.

__________________________ __________________________

Calderón Rivera, Andrea Del Valle Mendoza, Juana

__________________________

Espinal Reyes, María de Fátima

__________________________

Palacios Cuervo, Fernando